Role Of An Arabidopsis Ap2 Erebp Type Transcriptional -Books Pdf

Role of an Arabidopsis AP2 EREBP Type Transcriptional
27 Mar 2020 | 8 views | 0 downloads | 13 Pages | 493.53 KB

Share Pdf : Role Of An Arabidopsis Ap2 Erebp Type Transcriptional

Download and Preview : Role Of An Arabidopsis Ap2 Erebp Type Transcriptional


Report CopyRight/DMCA Form For : Role Of An Arabidopsis Ap2 Erebp Type Transcriptional



Transcription

Transcriptional Repressor and ABA Response 2385, repression by unliganded receptors and by the Mad Mxi protein GST AtERF7 or GST RB for the maize retinoblastoma protein. Pazin and Kadonaga 1997 Recent studies have revealed a wide Halfter et al 2000 bound to glutathione agarose beads was. range of DNA binding transcription factors REST NRSF MNF b incubated with PKS3 obtained by in vitro translation and labeled. p53 and MeCP2 associated with Sin3 Knoepfler and Eisenman using 35S Met After extensive washing the bound PKS3 was. 1999 Brubaker et al 2000 Although yeast Sin3 does not pos detected by SDS PAGE 35S Met labeled PKS3 protein was. sess DNA binding activity it can repress transcription when pulled down by GST AtERF7 but not by GST RB Figure 1D. coupled to a heterologous DNA binding domain thus it may To test whether AtERF7 and PKS3 can also interact in vivo. repress transcription by tethering to DNA by a sequence specific Myc tagged PKS3 PKS3 MYC and hemagglutinin HA tagged. DNA binding protein Ayer et al 1995 Recent studies sugges AtERF7 AtERF7 HA were transfected into Arabidopsis proto. ted important roles of histone deacetylase in plant development plasts either separately or together PKS3 Myc was then precipi. Lusser et al 2001 Meyer 2001 AtHD1 is the Arabidopsis tated with anti Myc antibodies Figure 1E shows that AtERF7 HA. homolog of yeast RPD3 and human HD1 Reduction of AtHD1 was detected in the proteins precipitated by anti Myc from pro. HDA19 mRNA levels by an antisense approach resulted in the toplasts cotransfected with both PKS3 Myc and AtERF7 HA. accumulation of tetra acetylated H4 and pleiotropic develop The results demonstrate that PKS3 and AtERF7 could be co. mental defects Tian and Chen 2001 Similarly antisense in immunoprecipitated Control experiments show that AtERF7. hibition of AtRPD3A delayed flowering in transgenic Arabidopsis did not coimmunoprecipitate with HOS1 a RING finger protein. plants suggesting that histone acetylation may play a role in encoded by the high expression of osmotically responsive gene l. controlling genes involved in the transition from the vegetative to locus of Arabidopsis Lee et al 2001 from protoplasts cotrans. the reproductive phase of development Wu et al 2000 More fected with AtERF7 HA and HOS1 Myc Figure 1E These results. recently HDA19 was reported to be involved in jasmonic acid suggest that AtERF7 and PKS3 interact in vivo in plant cells. and ethylene signaling during the pathogen response in Arabi To determine whether AtERF7 can be a substrate of PKS3 we. dopsis Zhou et al 2005 expressed the PKS3 and AtERF7 proteins in Escherichia coli as. In this study we identified AtERF7 a member of the ethylene GST fusion proteins The kinase activity was assayed by in. responsive element binding factor family as an important tran cubation of AtERF7 and PKS3 in the presence of g 32P ATP in. scriptional repressor in ABA responses AtERF7 interacts with a kinase buffer Figure 1F shows that PKS3 phosphorylated. PKS3 and can be phosphorylated by PKS3 in vitro AtERF7 also AtERF7 suggesting that AtERF7 can be a substrate of PKS3 at. interacts with the transcriptional corepressor AtSin3 which in least in vitro. turn may interact with the histone deacetylase HDA19 AtSin3. and HDA19 enhance the transcription repression activity of AtERF7 Overexpression or Knockdown Increases or. AtERF7 Overexpression of AtERF7 in transgenic Arabidopsis Reduces ABA Sensitivity in Guard Cells Respectively. plants reduced ABA responses in guard cells and decreased. drought tolerance whereas reductions in AtERF7 expression To investigate the in vivo function of AtERF7 we overexpressed. caused ABA hypersensitivity in guard cells seed germination it by fusing its coding region to the constitutive super promoter. and seedling growth Our findings reveal a potential link between Narasimhulu et al 1996 and introducing the construct into. ABA signaling and chromatin remodeling Arabidopsis Twenty three T3 homozygous transgenic lines were. recovered and a representative line with high AtERF7 expres. sion Figure 2A was used for detailed analysis We tested. RESULTS whether drought tolerance is affected by AtERF7 overexpres. sion After withholding water for 2 weeks wild type leaves re. AtERF7 Interacts with PKS3 mained green and turgid but AtERF7 overexpression transgenic. plants wilted Figure 2B To determine whether the overexpres. In a yeast two hybrid screen using the protein kinase SOS2 as sion of AtERF7 affects the sensitivity of guard cells to ABA we. a bait to screen for proteins that may interact with SOS2 and measured the changes in stomatal aperture after ABA treatment. possibly with other protein kinases in the SOS2 family we found We exposed wild type and AtERF7 overexpression transgenic. AtERF7 At3g20310 as a very weak SOS2 interacting protein plants to strong light and high humidity to induce full stomatal. U Halfter and J K Zhu unpublished results We tested other pro opening and then excised the leaves and placed them in. tein kinases in the SOS2 family and found that PKS3 shows a stomatal opening buffer for 2 h After ABA treatment wild type. strong interaction with AtERF7 Figures 1A and 1B Other kinases plants showed greatly reduced stomatal aperture 48 whereas. related to PKS3 such as PKS11 and PKS18 Gong et al 2002a AtERF7 overexpression plants showed stomatal aperture reduc. 2002b do not interact with AtERF7 Figures 1B and 1C These tion of only 8 Figure 2D These data suggest that stomatal. results indicate that AtERF7 preferentially interacts with PKS3 closure is less sensitive to ABA in AtERF7 overexpression plants. AtERF7 is a putative transcriptional repressor in the AP2 To assess the functional consequence of the loss of function of. EREBP family Ohta et al 2001 AtERF3 is a closely related AtERF7 we generated aterf7 RNA interference RNAi lines using. protein in the transcriptional repressor subfamily However as gene specific sequences Chuang and Meyerowitz 2000 The. shown in Figures 1A and 1C AtERF3 does not interact with PKS3 expression of AtERF7 was examined by RT PCR in two randomly. Therefore PKS3 appears to interact specifically with AtERF7 chosen independent aterf7 aterf7 1 and aterf7 3 RNAi lines The. To confirm the interaction between AtERF7 and PKS3 we result shows that AtERF7 expression was knocked down in the. performed a glutathione S transferase GST pulldown assay RNAi lines Figure 2C Control experiments showed that AtERF3. 2386 The Plant Cell,Figure 1 PKS3 Specifically Interacts with AtERF7. A PKS3 interacts with AtERF7 but not AtERF3 in the yeast two hybrid assay Yeast strains containing pAS PKS3 as bait and pACT AtERF7 as prey. were grown on SC medium lacking Trp and Leu for 48 h left panel and were assayed for LacZ expression by a filter lift assay right panel pACT AtERF3. and the empty prey vector were used as negative controls Blue color indicates interaction b gal b galactosidase activity. B AtERF7 interacts with PKS3 but not PKS11 or PKS18 in the yeast two hybrid assay. C Quantitative analysis of b galactosidase activity of the yeast strains in liquid culture showing the interaction between AtERF7 and PKS3 as well as. with the control partners ERF3 PKS11 and PKS18 Values are the means of data taken from three independent experiments Error bars indicate. standard deviation, D PKS3 interacts with AtERF7 in vitro Radiolabeled PKS3 was pulled down by GST AtERF7 but not by GST RB. E AtERF7 interacts with PKS3 in vivo AtERF7 HA and PKS3 Myc were transiently coexpressed in wild type protoplasts and then PKS3 Myc was. precipitated with anti Myc The precipitated anti Myc samples were subjected to anti HA protein gel blot analysis AtERF7 did not coimmunoprecipitate. F In vitro phosphorylation of AtERF7 by PKS3, the most closely related gene to AtERF7 was not affected in the loss we compared the rate of water loss in excised leaves from. AtERF7 RNAi lines Twenty two aterf7 RNAi lines were germi wild type and AtERF7 overexpression transgenic plants The. nated on MS nutrient agar plates Sigma Aldrich St Louis MO AtERF7 overexpression plants showed faster water loss than. supplemented with 0 5 mM ABA All but two of the aterf7 lines wild type plants Figure 2E This result is consistent with the. were more sensitive to ABA The ABA hypersensitive pheno rapid wilting in overexpression plants upon drought treatment To. types of aterf7 cosegregated with the hygromycin resistance determine whether AtERF7 might be expressed in guard cells we. marker data not shown fused the AtERF7 promoter region to the b glucuronidase GUS. We further analyzed two representative T3 homozygous lines reporter and analyzed GUS activity in transgenic plants As. Stomatal apertures in response to ABA were also investigated in shown in Figure 2F the AtERF7 promoter was highly active in. the AtERF7 RNAi lines As shown in Figure 2D 1 mM ABA caused leaf guard cells suggesting that AtERF7 is expressed in guard. more stomatal closure in the AtERF7 RNAi lines compared with cells. wild type plants Thus stomatal closing in the AtERF7 RNAi lines. is more sensitive to ABA than in the wild type These results AtERF7 Binds to the GCC Box and Acts as a Repressor. suggest that AtERF7 plays an important role in controlling ABA of GCC Box Mediated Transcription. sensitivity in guard cells, To determine whether the decreased stomatal sensitivity to The amino acid sequence of AtERF7 suggests that it is a tran.
ABA in the overexpession lines affects plant transpirational water scription factor Ohta et al 2001 Consistent with AtERF7 being. Transcriptional Repressor and ABA Response 2387, Figure 2 Role of AtERF7 in Controlling Transpirational Water Loss and Guard Cell Sensitivity to ABA. A Expression of AtERF7 in one AtERF7 overexpression transgenic line line 1. B Increased wilting of transgenic plants with AtERF7 overexpression OE under drought stress Both wild type and transgenic plants were grown. under normal conditions for 15 d and then subjected to drought stress. C RT PCR results showing AtERF7 top gel and AtERF3 bottom gel expression in the wild type and two independent lines of aterf7 RNAi lines. Tubulin primers were used in PCR as an internal control. D Stomatal behavior in the wild type and AtERF7 RNAi lines aterf7 1 and aterf7 3 and overexpression plants in response to ABA Stomata were. opened by exposing plants for 12 h to light and high humidity and leaves were incubated for 1 5 h in stomatal opening solution containing 50 mM KCl. 10 mM CaCl2 and 10 mM Mes pH 6 15 Stomatal apertures were measured 1 5 h after adding 2 mM ABA Data represent means 6 SD n 140 to 150. E Water loss from excised leaves of the wild type and AtERF7 RNAi lines and transgenic plants with AtERF7 overexpression Data represent means 6. SD of three independent experiments 12 to 15 measurements per point. F Expression of AtERF7 promoter GUS in guard cells. a putative transcription factor an AtERF7 green fluorescent a transcriptional repressor we performed transient expression. protein GFP fusion protein was localized to the nucleus data experiments in Arabidopsis leaves using a reporter gene that. not shown To analyze the DNA binding activity of AtERF7 we has four tandem copies of the GCC box sequence around the. expressed the protein as a GST fusion in E coli Electrophoretic HOOKLESS promoter 4 3 HLS GCC LUC Fujimoto et al 2000. mobility shift assay results shown in Figure 3B reveal that the Expression of AtERF7 resulted in a substantial reduction of the. recombinant AtERF7 fusion protein binds to a 16 bp oligonucleo expression of 4 3 HLS GCC LUC Figure 3D AtERF5 was. tide probe containing the GCC box Figure 3A By contrast known to act as an activator of GCC box mediated transcription. AtERF7 does not bind to the oligonucleotide probe containing Fujimoto et al 2000 AtERF5 induced an activation of 4 3 HLS. the mutant GCC box Figure 3B The mutant GCC box Figure GCC LUC by fivefold but coexpression of AtERF7 prevented. 3A contains two point mutations that were shown to eliminate or this activation Figure 3D The observed repression was specific. reduce GCC box activity in vivo Ohme Takagi and Shinshi as a reporter lacking the GCC box was not affected by AtERF7. 1995 In addition the control protein GST is unable to bind the data not shown. wild type GCC box Figure 3B To begin to assess the role of AtERF7 in ABA mediated gene. AtERF7 is highly similar to AtERF3 which has been shown to expression in plants we used semiquantitative RT PCR analysis. be a repressor of GCC box mediated transcription Fujimoto to compare two ABA induced genes in the wild type and the. et al 2000 Ohta et al 2001 To test whether AtERF7 is also AtERF7 overexpression line Previous studies showed that the. 2388 The Plant Cell, Figure 3 AtERF7 Binds to the GCC Box and Acts as a Transcriptional Repressor. A GCC box sequences used in the experiments The GCC box sequence is underlined GCC wild type GCC box sequence mGCC GCC box with two. mutations The two nucleotides mutated in mGCC are outlined. B AtERF7 binding to the GCC box Electrophoretic mobility shift assay involved the use of a GST AtERF7 fusion protein and a 16 bp wild type GCC. box oligonucleotide left gel or a mutated version right gel Free probe FP GST alone or 0 1 mg of GST AtERF7 was used in the reaction as indicated. C Schemes of the reporter and effector plasmids The Gal4 binding site and GCC box sequence were fused to a minimal TATA box and the LUC gene. The AtERF7 and AtERF5 effector plasmids were under the control of the CaMV 35S promoter V translational enhancer of tobacco mosaic virus Nos. the terminator signal of the gene for nopaline synthase. D Repression of reporter gene activity by AtERF7 and suppression of AtERF5 mediated transactivation by AtERF7 To normalize values obtained after. each transfection a gene for luciferase from Renilla was used as an internal control Luciferase activity is expressed in arbitrary units relative to the. activity of Renilla luciferase as described by Ohta et al 2001 Values shown are means of data taken from three independent experiments error bars. indicate SD, E AtERF7 overexpression reduces the expression of genes containing the GCC box in their promoter regions under ABA treatment Wild type and. AtERF7 overexpression plants were treated with 100 mM ABA for 6 h and total RNAs were isolated from the treated and untreated wild type and. transgenic plants Actin2 primers were used in PCR as an internal control. PDF1 2a At5g44420 gene encoding a plant defensin has alterations of chromatin remodeling Wolffe 1996 Goodrich and. a typical GCC box GCCGCC in the promoter region Brown Tweedie 2002 Both yeast and mammalian Sin3 can interact. et al 2003 Our database survey found that the CAX8 with DNA binding proteins Wang and Stillman 1990 Ayer et al. At5g17850 gene also has a typical GCC box in the promoter 1995 and Sin3 mediated repression of transcription may in. region These genes were induced by ABA Figure 3E consistent volve the recruitment of histone deacetylase Alland et al 1997. with previous findings H Okamoto and M Knight unpublished Hassin et al 1997 Heinzel et al 1997 David et al 1998. data We found that the ABA upregulation of these genes was Knoepfler and Eisenman 1999 We hypothesized that the re. blocked in the AtERF7 overexpression line compared with wild pression mechanism of AtERF7 in ABA responses might involve. type plants suggesting that AtERF7 may have a role in ABA corepressors such as Sin3 and histone deacetylase to effect. mediated gene expression in plants transcriptional repression via the modification of chromatin. structure To test this hypothesis we surveyed the Arabidopsis. Interaction between AtERF7 AtSin3 and HDA19 genome and found a Sin3 like protein At1g24190 that is. highly similar to animal and yeast Sin3 and that possesses. There is growing evidence that transcriptional repression events three putative paired amphipathic helix PAH domains We. critical to all biological processes may result from regulated tested potential interactions among the Arabidopsis AtSin3. Transcriptional Repressor and ABA Response 2389, AtERF7 and HDA19 At4g38130 Tian and Chen 2001 using which suggests that the effect of AtSin3 and HDA19 on tran. a yeast two hybrid system An AtSin3 GAL4 DNA binding do scription repression is dependent on AtERF7 Consistent with. main fusion construct was used to produce the bait protein with these results transfection of plasmids encoding AtSin3 and. pACT AtERF7 and pACT HDA19 as preys Cotransformation of HDA19 in AtERF7 overexpression transgenic leaves resulted in. yeast Y190 with these constructs pAS AtSin3 with pACT increased transcription repression Figure 5B column 4 versus. AtERF7 pAS AtSin3 with pACT HDA19 yielded His Trp Leu column 3 significant difference according to the Steel Dwass. auxotrophs that were also positive for b galactosidase ex test P 0 05 This effect is most likely attributable to the high. pression Figure 4A Separate transformation of Y190 with level of AtERF7 protein present in the AtERF7 overexpression. either pAS AtSin3 or pACT AtERF7 alone did not allow yeast transgenic line Thus the results suggest that AtERF7 may. growth on selective plates and transformants did not express function in transcriptional repression together with AtSin3 and. b galactosidase In addition with yeast colonies from the co HDA19. transformation of pAS AtSin3 with an empty prey vector or with. the control prey protein an RNA binding protein b galactosidase. Reduced Expression of AtERF7 or AtSin3, activity was not detected These results show that AtSin3 inter.
Causes ABA Hypersensitivity, acts with both AtERF7 and HDA19 in the yeast two hybrid system. Figures 4A and 4C AtSin3 was knocked down by RNAi RT PCR analysis shows. The PAH domains of Sin3 are important for its function as a that AtSin3 expression was knocked down in the RNAi lines. transcriptional repressor and for protein protein interactions Figure 6A We tested the seed germination of representative T3. Wang and Stillman 1993 Ayer et al 1995 To determine homozygous RNAi lines of AtERF7 and AtSin3 aterf7 1 aterf7 3. whether the PAH regions of Arabidopsis AtSin3 are important atsin3 2 and atsin3 4 in response to ABA When seeds were. for the interaction with AtERF7 or HDA19 we constructed pAS planted in MS agar medium the aterf7 and atsin3 RNAi seeds. PAH amino acid residues 1 to 336 as a bait After transforming germinated and the seedlings grew as well as the wild type. Y190 with pAS PAH and pACT AtERF7 or pACT HDA19 we seedlings Figure 6B By contrast when seeds were planted in. found that the PAH domain interacted with AtERF7 and HDA19 MS medium supplemented with 1 mM ABA the RNAi seeds ger. Figure 4B No interaction was detected between AtERF7 or minated later than the wild type seeds Even though the RNAi. HDA19 with AtSin3 fragments that lacked the PAH domains data seeds eventually germinated their growth and development. not shown were delayed by ABA data not shown The ABA dose response. To test whether AtERF7 and AtSin3 can also interact in vivo curves are presented in Figure 7C for lines aterf7 1 and atsin3 2. coimmunoprecipitation experiments were performed GFP In our quantitation of seed germination only seedlings with green. tagged AtSin3 GFP AtSin3 and HA tagged AtERF7 AtERF7 HA cotyledons were scored as germinated These results show that. were transfected into Arabidopsis protoplasts together GFP reduced expression of AtERF7 or AtSin3 leads to ABA hyper. AtSin3 was then precipitated with anti GFP antibodies The sensitivity in germination. results show that AtERF7 HA was detected in the proteins pre We constructed the double RNAi lines aterf7 1 atsin3 2. cipitated by anti GFP from protoplasts cotransfected with both aterf7 1 pks3 1 and atsin3 2 pks3 1 by crossing the respective. GFP AtSin3 and AtERF7 HA demonstrating that AtSin3 and single RNAi lines On MS medium without ABA the double or. AtERF7 could be coimmunoprecipitated Control experiments single RNAi lines germinated and grew similarly to the wild type. show that AtERF7 did not coimmunoprecipitate with HOS1 from However when they were germinated and grown on MS medium. protoplasts cotransfected with AtERF7 HA and GFP HOS1 supplemented with 0 25 mM ABA it is clear that the single RNAi. Figure 4D These results suggest that AtERF7 and AtSin3 interact lines were more sensitive to ABA and the double RNAi lines were. in vivo in plant cells even more sensitive than the single RNAi lines Figure 7 The. greater ABA sensitivity of the double RNAi lines was indicated by. AtSin3 and HDA19 Enhance AtERF7 Mediated the lack of cotyledon expansion on 0 25 mM ABA Figure 7. Transcriptional Repression Unlike the wild type or single RNAi lines Figure 7B the double. RNAi lines could not germinate on MS agar medium containing. To investigate the role of AtSin3 and HDA19 in AtERF7 mediated 1 mM ABA Figure 7D. repression of transcription we tested the effect of AtSin3 and. HDA19 on the ability of AtERF7 to regulate transcription in plant. cells with the use of transient assays Coexpression of AtERF7 DISCUSSION. with the 4 3 HLS GCC LUC reporter resulted in a 74 reduction. in basal LUC transcription activity Figure 5A column 1 versus In this study we identified a transcriptional repressor that is. column 2 significant difference according to the Steel Dwass important for ABA responses and provided evidence that sug. test P 0 05 Coexpression of AtERF7 AtSin3 HDA19 and the gests a connection between ABA signaling and gene repression. 4 3 HLS GCC LUC reporter resulted in a further reduction in by chromatin remodeling Our genetic analysis showed that. transcription activity Figure 5A column 2 versus column 3 sig AtERF7 and AtSin3 play important roles in mediating ABA re. nificant difference according to the Steel Dwass test P 0 05 sponses in Arabidopsis Transgenic lines overexpressing AtERF7. Importantly the transcription was not substantially reduced by showed reduced sensitivity to ABA in stomatal closure and in. coexpression of AtSin3 and HDA19 and the 4 3 HLS GCC LUC creased sensitivity to drought stress Figure 2 Consistent with. reporter without AtERF7 Figure 5A column 1 versus column 4 this finding Arabidopsis RNAi lines with AtERF7 expression. Figure 4 AtSin3 Interacts with AtERF7 and HDA19 in the Yeast Two Hybrid System and Coimmunoprecipitation between AtSin3 and AtERF7. A AtSin3 interacts with AtERF7 or HDA19 but not with SOS1 Yeast strains containing pAS AtSin3 bait and or pACT AtERF7 and pACT HDA19 prey. were assayed for LacZ expression Yeast grown on yeast peptone dextrose YPD is shown in the top panel b galactosidase filter assay results are. shown in the bottom panel The middle panel shows yeast growth on SC medium lacking Trp and Leu SC L T 1 pAS AtSin3 2 pACT AtERF7 3. pAS AtSin3 pACT 4 pAS AtSin3 pACT AtERF7 5 pAS AtSin3 6 pACT HDA19 7 pAS AtSin3 pACT 8 pAS AtSin3 pACT HDA19 9 pAS. AtSin3 pACT RBP, B The PAH domain of AtSin3 amino acid residues 1 to 336 is required for interactions with AtERF7 and HDA19 1 pAS PAH 2 pACT AtERF7 3 pAS. PAH pACT 4 pAS PAH pACT AtERF7 5 pAS PAH 6 pACT HDA19 7 pAS PAH pACT 8 pAS PAH pACT HDA19 9 pAS PAH pACT. SOS1 10 pAS PAH pACT RBP SOS1 and RBP an RNA binding protein were used as negative controls. C Quantitative analysis of b galactosidase activity of the yeast strains in liquid culture showing the interaction between AtSin3 and AtERF7 or HDA19. Values are the means of data taken from three independent experiments Error bars indicate standard deviation. D AtERF7 interacts with AtSin3 in vivo AtERF7 HA and GFP AtSin3 were transiently coexpressed in wild type protoplasts and then GFP AtSin3 was. precipitated with anti GFP The precipitated anti GFP samples were subjected to anti HA protein gel blot analysis AtERF7 did not coimmunopre. cipitate with HOS1,Transcriptional Repressor and ABA Response 2391. Figure 5 AtERF7 Mediated Transcription Repression Is Enhanced by HDA19 and AtSin3. A Repression of reporter gene activity by AtERF7 AtSin3 and HDA19. B Comparison of AtSin3 and HDA19 mediated repression activity in wild type and AtERF7 overexpression OE leaves. Values shown are means of data from three independent experiments error bars indicate SD. knocked down displayed increased sensitivity to ABA in stomatal late the expression of some ABA induced genes It appears that. closing as well as seed germination The effects observed with the role of AtERF7 may be to attenuate ABA responses in Arabi. AtERF7 overexpression or RNAi plants are not necessarily dopsis It is unknown at present whether AtERF7 also functions. specific for AtERF7 because we did not test the effect of in other signaling pathways such as ethylene and defense. overexpression or RNAi of AtERF3 or AtERF4 AtSin3 RNAi lines responses that are known to involve the ERF family of tran. also were more sensitive to ABA in seed germination Figure 6B scription factors and their binding to the GCC box of target gene. Our results indicate that AtERF7 overexpression may downregu promoters Fujimoto et al 2000. Figure 6 The aterf7 and atsin3 RNAi Lines Show ABA Hypersensitivity in Seed Germination. A RT PCR results showing AtSin3 top gel and an AtSin3 homolog At1g70060 bottom gel expression in the wild type and two independent atsin3. RNAi lines Tubulin primers were used in PCR as an internal control. B Germination sensitivity to ABA Seeds from the wild type two aterf7 RNAi lines and two atsin3 RNAi lines were germinated and grown on MS agar. medium left panel or MS agar supplemented with 1 mM ABA right panel for 10 d. C Comparisons of germination rates of wild type and aterf7 and atsin3 RNAi seeds after exposure to different concentrations of ABA for 5 d Data. represent means 6 SD of three independent experiments 110 seeds per point. 2392 The Plant Cell, Figure 7 ABA Sensitivity in aterf7 atsin3 aterf7 pks3 and atsin3 pks3 Double RNAi Lines. A Fifteen day old seedlings of the wild type two single RNAi lines aterf7 and atsin3 and a double RNAi line grown in MS medium with or without. 0 25 mM ABA DR the double RNAi line aterf7 1 atsin3 2. B Fifteen day old seedlings of the wild type two single RNAi lines aterf7 and pks3 and a double RNAi line grown in MS medium with or without. 0 25 mM ABA DR the double RNAi line aterf7 1 pks3 1. C Fifteen day old seedlings of the wild type two single RNAi lines atsin3 and pks3 and a double RNAi line grown in MS medium with or without. 0 25 mM ABA DR the double RNAi line atsin3 2 pks3 1. D Germination of wild type open squares aterf7 atsin3 closed circles aterf7 pks3 open triangles and pks3 atsin3 open circles seeds in the. presence of different concentrations of ABA at d 4 after imbibition Results are averages of three replicates 6 SD. AtERF7 is very similar to AtERF3 and AtERF4 both of which present it is unclear whether AtSin3 is specific for the AtERF7. have been shown to be transcription repressors Fujimoto et al pathway because we do not have data on the specificity of in. 2000 Sequence analysis revealed that AtERF7 possesses the teraction between AtSin3 and the various AtERF proteins. repression domain FDLNFXP Ohta et al 2001 which could Several protein kinases including PKS3 have been impli. bind to the GCC box in gene promoters Our survey of the cated in ABA signaling Sheen 1996 Li et al 2000 Guo et al. Arabidopsis genome database found 400 genes containing 2002 Jiang et al 2003 Reduced expression of Arabidopsis. the GCC box sequence in their promoter regions P Wang C P PKS3 by RNAi causes ABA hypersensitivity in seed germination. Song and J K Zhu unpublished data AtERF7 may regulate at seedling growth and stomatal closure PKS3 interacts with. least a subset of these genes and some or all of the AtERF7 calcium sensors SCaBP5 and others and with ABI2 Guo et al. target genes may function in the ABA pathway We showed that 2002 We found that AtERF7 interacted with PKS3 Figure 1. AtERF7 can indeed repress the basal transcription level of and can be phosphorylated by PKS3 in vitro Figure 1F Further. a reporter gene and the transactivation activities of transcrip more the aterf7 and pks3 RNAi lines were similar in their ABA. tional activators Figure 3D This finding suggests that AtERF7 hypersensitivity The aterf7 pks3 double RNAi line showed a more. uses an active repression mechanism There are several possi dramatic ABA phenotype compared with the single RNAi lines. ble mechanisms of active repression Cowell 1994 Pazin and and wild type plants Figure 7 These results suggest that. Kadonaga 1997 One is that the transcription factor might re AtERF7 could be a target protein of PKS3 in the ABA signal. cruit corepressors such as histone deacetylase which modifies transduction pathway Phosphorylation by PKS3 may increase. chromatin structure and prevents transcription activators from the DNA binding and or repression activity of AtERF7. binding to the cis elements Pazin and Kadonaga 1997 Yeast Our results suggest a model in which AtERF7 bound to. two hybrid assays and coimmunoprecipitation suggested that the GCC box of ABA induced genes and regulated by PKS3. AtERF7 interacts with AtSin3 which in turn may interact with mediated phosphorylation may recruit an AtSin3 HDA19 co. HDA19 Figure 4 Thus in Arabidopsis a repressor complex repressor complex to repress further gene transcription as part. consisting possibly of AtSin3 and HDA19 may be targeted to of the mechanism of attenuation of ABA signaling Although we. relevant gene promoters via their association with AtERF7 At still do not know whether AtERF7 is phosphorylated in vivo by. Transcriptional Repressor and ABA Response 2393, PKS3 and how phosphorylation might affect the activity of a final extension step 728C for 10 min The amplification products were.
AtERF7 our observation of the interaction between AtERF7 then analyzed on 1 agarose gels. and PKS3 suggests that the DNA binding and or transcriptional. Histochemical Analysis of GUS Activity, repressor activity of AtERF7 may be regulated by PKS3 via. phosphorylation Our model provides a conceptual framework in A DNA fragment containing 1627 bp upstream of the AtERF7 start codon. which to integrate the molecular mechanisms of transcription was amplified by PCR with oligonucleotides incorporating the BamHI. repression caused by stresses and stress hormones e g ABA and SalI sites The PCR fragment was digested with BamHI and SalI. and may be relevant to the molecular mechanism of plant and then cloned into the SalI BamHI site of the promoterless GUS ex. memory of stress or ABA treatment Goh et al 2003 Our re pression vector pCMB1381 The construct ERF7 GUS was transferred. sults together with those obtained in yeast and mammalian from Escherichia coli DH5a into A tumefaciens GV3101 Arabidopsis. plants were transformed by floral infiltration with A tumefaciens contain. cells Hassin et al 1997 Nagy et al 1997 suggest that Sin3. ing pAtERF7 GUS Histochemical localization of GUS activities in the. histone deacetylase is an evolutionarily conserved corepressor. transgenic plants was analyzed after incubating the transgenic plants in. complex that represses the transcription of specific genes using X gluc buffer 50 mM sodium phosphate buffer pH 7 0 10 mM EDTA. sequence specific DNA binding proteins to target a chromatin 0 1 Triton X 100 0 5 mM potassium ferrocyanide and 2 mg mL. modifying activity to gene specific promoters Future studies 5 bromo 4 chloro 3 indolyl glucuronide X gluc at 378C for 12 h. are needed to determine the spectrum of genes regulated by. chromatin remodeling via sequence specific transcriptional re. pressors such as AtERF7 and how the repressor complex may Overexpression of AtERF7. be regulated by ABA signaling, For AtERF7 overexpression the open reading frame of AtERF7 was. amplified by PCR using the following primers 59 TCTAGATGAGGAAA. GGGAGAGGCTCTTC 39 the XbaI site is underlined and 59 GGTACCT. CAGAGACGTAGATCGGTACA 39 the KpnI site is underlined The PCR. products were first cloned into pBluescript SK Stratagene La Jolla CA. and confirmed by sequencing Then the AtERF7 open reading frame was. RNAi released by digesting with XbaI and KpnI and subcloned into pBIB vector. under the control of the superpromoter which consists of three copies of. Gene specific cDNA fragments of AtERF7 and AtSin3 were amplified. the octopine synthase upstream activation sequence in front of the. by PCR with the following primer pairs forward primer 59 CGGG. manopine synthase promoter Narasimhulu et al 1996 The construct. ATCCATTTAAATCCTGGAAATTACCTCCGCCG 39 and reverse primer. was transformed into Arabidopsis plants ecotype Columbia and the. 59 GGACTAGTGGCGCGCCGGTGGATCTGTGAAGGAGCC 39 for AtERF7. resulting T3 transgenic lines were tested for ABA and drought sensitivity. forward primer 59 CGGGATCCATTTAAAGAGCGTGCACACGATTCAA. CTGC 39 and reverse primer 59 GGACTAGTGGCGCGCCAAATCATC. CTCCGGATCTTCACC 39 for AtSin3 The forward primers contain. BamHI and SwaI restriction sites and the reverse primers contain SpeI Semiquantitative RT PCR. and AscI restriction sites underlined The resulting PCR product was Five micrograms of total RNA from each sample was used to synthesize. digested with AscI and SwaI and ligated to the AscI SwaI cleaved vector the first strand cDNA with the SuperScript preamplification system using. pFGC1008 http Ag Arizona Edu chromatin chromatin html The cloned the First Strand cDNA Synthesis kit Gibco BRL The yield of cDNA was. fragments were sequenced to ensure that the correct cDNA was am measured according to the PCR signal generated from the internal. plified and cloned This plasmid served as a template to generate a se standard the housekeeping gene b actin amplified from 18 to 24 cycles. cond PCR fragment to complete the inverted repeat construct The starting with 0 1 mL of the cDNA solution The volume of each cDNA pool. primers used to isolate the first PCR fragment were also used for the was adjusted to give the same exponential phase PCR signal strength for. second fragment This second PCR fragment was cleaved with BamHI b actin after 20 cycles The resulting cDNAs were subjected to PCR with. and XbaI and inserted into the BamHI XbaI sites of the template plasmid primers designed to amplify PDF1 2a and CAX8 DNAs The expression of. producing an inverted repeat interrupted by the 335 bp GUS sequence actin was used as an internal control The RT PCR product was analyzed. The double strand RNA construct was introduced into Agrobacterium by electrophoresis on a 1 5 agarose gel. tumefaciens strain GV3101 and transformed into wild type Arabidopsis. thaliana ecotype Columbia plants by floral infiltration. Total RNAs isolated from 2 week old seedlings of the wild type and. Yeast Two Hybrid Assay, RNAi lines erf7 1 erf7 3 atsin3 2 and atsin3 4 were used as templates. for reverse transcription by use of the SuperScript preamplification sys For yeast two hybrid assays the cDNA coding regions of AtSin3 PKS3. tem for first strand cDNA synthesis Gibco BRL Grand Island NY run PKS11 and Pka18 were amplified by PCR with primers containing re. for 50 min at 428C After cDNA synthesis 1 mL aliquots were taken for striction sites for BamHI and PstI and the amplified fragment was inserted. PCR detection of transcripts with the forward primers for RNAi lines into plasmid pAS2 Clontech Palo Alto CA to form pAS AtSin3 pAS. 59 ATGAGGAAAGGGAGAGGCTC 39 for AtERF7 and 59 GCATCATGTG PKS3 pAS PKS11 and pAS PKS11 as the baits AtERF7 ERF3 and. CATCAGCCATA 39 for AtSin3 The reverse primer sequences are not HDA19 were cloned in frame in the pACT2 vector between the BamHI. present in the gene specific AtERF7 and AtSin3 fragments in the RNAi EcoRI ERF3 and ERF4 and NcoI XhoI HDA19 sites to create plasmids. constructs therefore they amplify only the respective gene transcripts pACT AtERF7 pACT ERF3 and pACT HDA19 respectively The yeast. The reaction mixture 25 mL contained 13 PCR buffer 2 mM MgCl2 two hybrid interaction assay was performed as described Halfter et al. 0 2 mM deoxynucleotide triphosphates 1 2 units of Taq polymerase and 2000 Guo et al 2002 Transformants of yeast strain Y190 harboring both. 0 2 mM each of the primer pairs described above PCR consisted of 30 bait and prey were cultured in 2 mL of yeast peptone dextrose overnight A. cycles of 948C for 1 min 558C for 1 min and 728C for 1 min Cycling 5 mL suspension containing 10 000 cells was dropped onto synthetic. was preceded by an initial denaturation step 948C for 2 min followed by complete SC medium lacking Trp and Leu and incubated at 308C for. 2394 The Plant Cell, 48 h Plasmid containing the C terminal portion of SOS1 Shi et al 2000 was transferred to 308C for 30 min The reaction contained 100 ng of. pAS SOS1C and a RNA binding protein C P Song and J K Zhu ERF7 protein on the glutathione Sepharose beads The reaction was. unpublished data pAS RBP were used as negative controls stopped by adding 0 5 mL of 0 5 M EDTA The beads were washed three. times with kinase buffer and samples were denatured by boiling for 4 min. then run on a 10 SDS PAGE gel,In Vitro and in Vivo Protein Interaction Assay.
To produce bacterially expressed GST ERF7 and GST RB Halfter et al. Electrophoretic Mobility Shift Assay, 2000 the coding regions of AtERF7 and RB Halfter et al 2000 cDNAs. were cloned in frame into the BamHI EcoRI sites of pGEX 2TK The Individual synthetic single stranded DNA molecules corresponding to. constructs were introduced into E coli BL21 DE3 cells Recombinant the 16 bp GCC box fragment 59 CATAAGAGCCGCCACT 39 and its. proteins were affinity purified from bacterial lysates with glutathione mutant 59 CATAAGATCCTCCACT 39 were annealed with their comple. Sepharose Amersham Pharmacia Biotech Buckinghamshire UK mentary oligonucleotides The resulting double stranded oligonucleo. Radiolabeled PKS3 proteins were produced from pET14b PKS3 by use tides were end labeled with g 32P ATP Amersham Pharmacia Biotech. of an in vitro transcription and translation assay kit TNT Coupled Reticulo and T4 polynucleotide kinase according to the manufacturer s instruc. cyte Lysate System Promega Madison WI with 35S Met as the sole tions Invitrogen Carlsbad CA DNA binding reactions were performed. source of Met according to the manufacturer s instructions Protein pull as described previously Ohme Takagi and Shinshi 1995 Briefly 0 1 mg. down assays were performed as described previously Guo et al 2002 each of the GST AtERF7 and GST or GST RB proteins was added to. In vivo coimmunoprecipitation experiments were performed as de a total volume of 10 mL in a binding buffer containing 10 mM Tris pH 8 0. scribed Guo et al 2002 1 mM EDTA 100 mM NaCl 2 mM DTT 10 glycerol and 10 fmol of the. wild type or mutant forms of the 16 bp oligonucleotide After being in. cubated for 15 min the reaction mixture was analyzed by electrophoresis. Epidermal Strip Bioassay and Water Loss Measurement. on 5 polyacrylamide gels prepared in 0 53 Tris Borate EDTA under. Stomatal bioassay experiments were performed as described Hugouvieux nondenaturing conditions. et al 2001 Zhang et al 2001 with slight modifications To study the. promotion of stomatal closure by ABA stomata were opened by ex. posing plants for 12 h to light and high humidity and incubating the leaves ACKNOWLEDGMENTS. for 1 5 h in stomata opening solution containing 50 mM KCl 10 mM CaCl. and 10 mM Mes pH 6 15 in a growth chamber at 22 to 258C under We thank R A Stevenson for help with the preparation of the manu. a photon flux density of 0 20 to 0 30 mmol m 2 s 1 Stomatal apertures script This work was supported by National Science Foundation Grant. were measured 1 5 h after adding 2 mM ABA IBN 0212346 National Institutes of Health Grant R01 GM 59138 the. For water loss measurement rosette leaves of the wild type the RNAi National Natural Science Foundation of China 30370765 and the. mutant and overexpression lines were detached from their roots placed National Key Basic Special Funds 2003CB114305. in weighing dishes and incubated on the laboratory bench Loss in fresh. weight was monitored at the indicated times, Received March 29 2005 revised May 26 2005 accepted June 7 2005. published July 1 2005,Transient Expression Assay, A plasmid for the expression of AtERF7 was constructed as follows The. Cauliflower mosaic virus CaMV 35S promoter and the GUS reporter REFERENCES. gene in pBI121 was replaced by 23 CaMV 35S promoter to generate 23. 35S Nos The cDNAs for AtERF7 AtSin3 and HDA19 were amplified Alland L Muhle R Hou H Potes J Chin L Schreiber Agus N. by PCR digested with SalI and inserted into SmaI and SalI sites of 23 and DePinho R A 1997 Role for NcoR and histone deacetylase in. 35S Nos 35S AtERF5 and 4 3 HLS GCC LUC were constructed previ Sin3 mediated transcriptional repression Nature 387 49 55. ously Fujimoto et al 2000 Ohta et al 2001 Allen G J Kuchitsu K Chu S P Murata Y and Schroeder J I. Transient expression was analyzed in Arabidopsis leaves by particle 1999 Arabidopsis abi1 1 and abi2 1 phosphatase mutations reduce. bombardment as described Fujimoto et al 2000 In brief 510 mg abscisic acid induced cytoplasmic calcium rises in guard cells Plant. of 1 mm gold biolistic particles Bio Rad Hercules CA was coated with Cell 11 1785 1798. 1 6 mg of reporter plasmid and 1 2 mg of effector plasmid or blank Assmann S M 2003 OPEN STOMATA1 opens the door to ABA. plasmid As a reference the Renilla LUC gene Promega under the signaling in Arabidopsis guard cells Trends Plant Sci 8 151 153. control of the CaMV 35S promoter was used at a reference gene reporter Assmann S M and Wang X Q 2001 From milliseconds to millions. gene ratio of 1 5 Bombardment was done using a PDS 1000 He particle of years Guard cells and environmental responses Curr Opin Plant. bombardment system DuPont Wilmington DE at 11 000 p s i After Biol 4 421 428. bombardment the samples were floated on 50 mM phosphate buffer Ayer D E Lawrence Q A and Eisenman N 1995 Mad max. pH 7 0 incubated in a plant growth chamber at 228C overnight frozen transcriptional repression is mediated by ternary complex formation. in liquid nitrogen and quantified for LUC activity with mammalian homologs of yeast repressor Sin3 Cell 80 767 776. Brown R L Kazan K McGrath K C Maclean D J and Manners. J M 2003 A role for the GCC box in jasmonate mediated activation. Protein Kinase Assay, of the PDF1 2 gene of Arabidopsis Plant Physiol 132 1020 1032. PKS3 GST Guo et al 2002 and AtERF7 GST proteins were affinity Brubaker K Cowley S M Huang K Loo L Yochum G S Ayer. purified with glutathione Sepharose The kinase buffer included 20 mM D E Eisenman R N and Radhakrishnan I 2000 Solution. Tris HCl pH 8 0 5 mM MgCl2 50 mM ATP and 1 mM DTT The kinase re structure of the interacting domains of the Mad Sin3 complex. action was in a total volume of 20 mL and was started by adding 100 ng of Implications for recruitment of a chromatin modifying complex Cell. eluted PKS3 protein and 0 5 mL of g 32P ATP 5 mCi and the mixture 103 655 665. Transcriptional Repressor and ABA Response 2395, Chuang C F and Meyerowitz E M 2000 Specific and heritable Arabidopsis thaliana reveals new targets of abscisic acid and largely.
genetic interference by double stranded RNA in Arabidopsis thaliana impaired gene regulation in the abi1 1 mutant J Cell Sci 115. Proc Natl Acad Sci USA 97 4985 4990 4891 4900, Cowell I G 1994 Repression versus activation in the control of gene Hugouvieux V Kwak J M and Schroeder J I 2001 An mRNA cap. transcription Trends Biochem Sci 19 38 42 binding protein ABH1 modulates early abscisic acid signal trans. Cutler S Ghassemian M Bonetta D Cooney S and McCourt duction in Arabidopsis Cell 106 477 487. P 1996 A protein farnesyl transferase involved in abscisic acid Jiang J An G Wang P Wang P Han J Jia Y and Song C P. signal transduction in Arabidopsis Science 273 1239 1241 2003 MAP kinase specifically mediates the ABA induced H2O2. David G Alland L Hong S H Wong C W De Pinho R A and generation in guard cells of Vicia faba L Chin Sci Bull 48 1919. Dejean A 1998 Histone deacetylase associated with mSin3A 1926. mediates repression by the acute promyelocytic leukemia associated Knoepfler P S and Eisenman R N 1999 Sin meets NuRD and. PLZF protein Oncogene 14 2549 2556 other tails of repression Cell 99 447 450. Finkelstein R R Gampala S S and Rock C D 2002 Abscisic acid Koornneef M Reuling G and Karssen C M 1984 The isolation. signaling in seeds and seedlings Plant Cell 14 suppl S15 S45 and characterization of abscisic acid insensitive mutants of Arabi. Finkelstein R R and Lynch T J 2000 The Arabidopsis abscisic dopsis thaliana Physiol Plant 61 377 383. acid response gene ABI5 encodes a basic leucine zipper transcription Lee H Xiong L Gong Z Ishitani M Stevenson B and Zhu. factor Plant Cell 12 599 609 J K 2001 The Arabidopsis HOS1 gene negatively regulates cold. Finkelstein R R Wang M L Lynch T J Rao S and Goodman signal transduction and encodes a RING finger protein that displays. H M 1998 The Arabidopsis abscisic acid response locus ABI4 cold regulated nucleo cytoplasmic partitioning Genes Dev 15. encodes an APETALA2 domain protein Plant Cell 10 1043 912 924. 1054 Leung J and Giraudat J 1998 Abscisic acid signal transduction. Fujimoto S Y M Ohta M Ushi A Shinshi H and Ohme Takagi Annu Rev Plant Physiol Plant Mol Biol 49 199 222. M 2000 Arabidopsis ethylene responsive element binding factors Leung J Merlot S and Giraudat J 1997 The Arabidopsis. act as transcriptional activators of GCC box mediated gene expres ABSCISIC ACID INSENSITIVE 2 ABI2 and ABI1 genes encode. sion Plant Cell 12 393 404 homologous protein phosphatases 2C involved in abscisic acid signal. Giraudat J Hauge B M Valon C Smalle J Parcy F and transduction Plant Cell 9 759 771. Goodman H M 1992 Isolation of the Arabidopsis ABI3 gene by Li J Wang X Q Watson M B and Assmann S M 2000. positional cloning Plant Cell 4 1251 1261 Regulation of abscisic acid induced stomatal closure and anion. Goh C H Nam H G and Park Y S 2003 Stress memory in plants channels by guard cell AAPK kinase Science 287 300 303. A negative regulation of stomatal response and transient induction Lu C and Fedoroff N 2000 A mutation in the Arabidopsis HYL1. of rd22 gene to light in abscisic acid entrained Arabidopsis plants gene encoding a dsRNA binding protein affects responses to abscisic. Plant J 36 240 255 acid auxin and cytokinin Plant Cell 12 2351 2366. Gong D Gong Z Guo Y Chen X and Zhu J K 2002a Lusser A Kolle D and Loidl P 2001 Histone acetylation Lessons. Biochemical and functional characterization of PKS11 a novel Arabi from the plant kingdom Trends Plant Sci 6 59 65. dopsis protein kinase J Biol Chem 277 28340 28350 McCarty D R Hattori T Carson C B Vasil V Lazar M and. Gong D Gong Z Guo Y and Zhu J K 2002b Expression Vasil I K 1991 The Viviparous 1 developmental gene of maize. activation and biochemical properties of a novel Arabidopsis protein encodes a novel transcriptional activator Cell 66 895 905. kinase Plant Physiol 129 225 234 Merlot S Gosti F Guerrier D Vavasseur A and Giraudat J. Goodrich J and Tweedie S 2002 Remembrance of things past 2001 The ABI1 and ABI2 protein phosphatases 2C act in a negative. Chromatin remodeling in plant development Annu Rev Cell Dev feedback regulatory loop of the abscisic acid signalling pathway. Biol 18 707 746 Plant J 25 295 303, Guo Y Xiong L Song C P Gong D Halfter U and Zhu J K Meyer P 2001 Chromatin remodelling Curr Opin Plant Biol 4. 2002 A calcium sensor and its interacting protein kinase are global 457 462. regulators of abscisic acid signaling in Arabidopsis Dev Cell 3 Murphy M Ahn J Walker K K Hoffman W H Evans R M. 233 244 Levine A J and George D L 1999 Transcriptional repression by. Halfter U Ishitani M and Zhu J K 2000 The Arabidopsis SOS2 wild type p53 utilizes histone deacetylases mediated by interaction. protein kinase physically interacts with and is activated by the with mSin3A Genes Dev 13 2490 2501. calcium binding protein SOS3 Proc Natl Acad Sci USA 97 Mustilli A C Merlot S Vavasseur A Fenzi F and Giraudat J. 3735 3740 2002 Arabidopsis OST1 protein kinase mediates the regulation of. Hassin C A Fleisscher T C Billin A N Schreiber S L and Ayer stomatal aperture by abscisic acid and acts upstream of reactive. D E 1997 Histone deacetylase activity is required for full transcrip oxygen species production Plant Cell 14 3089 3099. tion repression by mSin3A Cell 89 341 347 Nagy L Kao H Y Chakravati D Lin R J Hassig C A Ayer. Heinzel T et al 1997 A complex containing N CoR mSin3 and D E Schreiber S L and Evans R M 1997 Nuclear receptor. histone deacetylase mediates transcriptional repression Nature 387 repression mediated by a complex containing SMRT mSin3A and. 43 48 histone deacetylase Cell 89 373 380, Himmelbach A Hoffmann T Leube M Hohener B and Grill E Narasimhulu S B Deng X Sarri R and Gelvin S B 1996 Early. 2002 Homeodomain protein ATHB6 is a target of the protein transcription of Agrobacterium T DNA genes in tobacco and maize. phosphatase ABI1 and regulates hormone responses in Arabidopsis Plant Cell 8 873 886. EMBO J 21 3029 3038 Ohme Takagi M and Shinshi H 1995 Ethylene inducible DNA. Himmelbach A Yang Y and Grill E 2003 Relay and control of binding proteins that interact with an ethylene responsive element. abscisic acid signaling Curr Opin Plant Biol 6 470 479 Plant Cell 7 173 182. Hoth S Morgante M Sanchez J P Hanafey M K Tingey S V Ohta M Masui K Hiratsu K Shinshi H and Ohme Takagi M. and Chua N H 2002 Genome wide gene expression profiling in 2001 Repression domains of class II ERF transcriptional repressors. 2396 The Plant Cell, share an essential motif for active repression Plant Cell 13 1959 protein regulation of ion channels and abscisic acid signaling in Arab. 1968 idopsis guard cells Science 292 2070 2072, Pazin M J and Kadonaga J T 1997 What s up and down with Wolffe A P 1996 Histone deacetylase A regulator of transcription.
histone deacetylation and transcription Cell 89 325 328 Science 272 371 372. Schroeder J I Kwak J M and Allen G J 2001 Guard cell abscisic Wu K Malik K Tian L Brown D and Miki B 2000 Functional. acid signalling and engineering drought hardiness in plants Nature analysis of a RPD3 histone deacetylase homologue in Arabidopsis. 410 327 330 thaliana Plant Mol Biol 44 167 176, Sheen J 1996 Specific Ca2 dependent protein kinase in stress Xiong L Gong Z Rock C D Subramanian S Guo Y Xu W. signal transduction Science 274 1900 1902 Galbraith D and Zhu J K 2001a Modulation of abscisic acid. Shi H Ishitani M Kim C and Zhu J K 2000 The Arabidopsis. signal transduction and biosynthesis by an Sm like protein in Arabi. thaliana salt tolerance gene SOS1 encodes a putative Na H anti. dopsis Dev Cell 1 771 781,porter Proc Natl Acad Sci USA 97 6896 6901. Xiong L Lee B h Ishitani M Lee H Zhang C and Zhu J K. Tian L and Chen Z J 2001 Blocking histone deacetylation in. 2001b FIERY1 encoding an inositol polyphosphate 1 phosphatase is. Arabidopsis induces pleiotropic effects on plant gene regulation and. development Proc Natl Acad Sci USA 98 200 205 a negative regulator of abscisic acid and stress signaling in Arabi. Wang H and Stillman D J 1990 In vitro regulation of a SIN3 dopsis Genes Dev 15 1971 1984. dependent DNA binding activity by stimulatory and inhibitory I fac Zhang X Zhang L Dong F Gao J Galbraith D W and Song. tors Proc Natl Acad Sci USA 87 9761 9765 C P 2001 Hydrogen peroxide is involved in abscisic acid induced. Wang H and Stillman D J 1993 Transcriptional repression in stomatal closure in Vicia faba Plant Physiol 126 1438 1448. Saccharomyces cerevisiae by a Sin3 LexA fusion protein Mol Cell Zhou C Zhang L Duan J Miki B and Wu K 2005 Histone. Biol 13 1805 1814 deacetylase 19 is involved in jasmonic acid and ethylene signaling of. Wang X Q Ullah H Jones A M and Assmann S M 2001 G pathogen response in Arabidopsis Plant Cell 17 1196 1204.


Related Books

Bounds on Locally Testable Codes - The Faculty of ...

Bounds on Locally Testable Codes The Faculty of

Bounds on Locally Testable Codes with Unique Tests y Gillat Kol Ran Raz Abstract The Unique Games Conjecture ( UGC ) is an important open problem in the re-search of PCPs and hardness of approximation. The conjecture is a strengthening of the PCP Theorem, predicting the existence of a special type of PCP veri ers:

Feeding Guidelines for Infants Healthy Eating and Young ...

Feeding Guidelines for Infants Healthy Eating and Young

provided to an infant or young child to provide nutrients and energy (P/B-24 Project2 working draft definition). EARLY CARE AND EDUCATION PROGRAMS Diverse non-parental child-care arrangements including child-care centers, home care by a relative, or home care by a non-relative.3 FIRST 1000 DAYS The life course period spanning from

Administration and Reference Guide Release 12.1.2.5.0 for ...

Administration and Reference Guide Release 12 1 2 5 0 for

Administration and Reference Guide Release 12.1.2.5.0 for Linux x86-64 ... 3-13 Creating a Snap Clone from a Template ...

IHSS Caregiver Employment Information

IHSS Caregiver Employment Information

Caregiver Employment . Information . Wages and Timesheets The wage in Sacramento County is $10.80 . an hour (as of 1/1/2014) There are two pay periods per month: 1st through the 15th of the month & 16th through the last day of the month Timesheets are due on or after the last working day of the pay period Do not

3MA/4MA Series - Comoso - Home

3MA 4MA Series Comoso Home

B3 Parker Hannifin Corporation Pneumatic Division Wadsworth, Ohio www.parker.com/pneumatics B 3MA/4MA 4MNR C S 3MAJ/4MAJ ACVB Option LPSO Option 3MA/4MA Series

ANAND KUMAR - University of South Florida

ANAND KUMAR University of South Florida

2013-2014 Received with Ms. Carol Osborne and Dr. Paul Solomon, approx.. $265,000 to study barriers to consumer adoption of a new technology based product. Grant provided by White Cloud e-cigarettes (approx. $132,500) and a matching grant (approx. $132,500) from Florida High Tech Corridor.

3MA Series - Hydraulic Industrial Services, Inc.

3MA Series Hydraulic Industrial Services Inc

3MA Series 3MA Mounting Styles for 1-1/2" to 5" Bore Sensors For sensors see page B339. Parker Hanni?n Corporation Pneumatic Division Richland, Michigan

Protected Disclosures Amendment Act 5 of 2017 (English ...

Protected Disclosures Amendment Act 5 of 2017 English

Tis gaette is also availale free online at www.gpwonline.co.a 2 No. 41016 GOVERNMENT GAZETTE, 2 AUGUST 2017 Act No. 5 of 2017 Protected Disclosures Amendment Act, 2017 GENERAL EXPLANATORY NOTE: [] Words in bold type in square brackets indicate omissions from existing enactments. Words underlined with a solid line indicate insertions in

Instruction Manual Model: DRX-4C

Instruction Manual Model DRX 4C

Instruction Manual Model DRX-4C CHAPTER 10. 13 5.Press the T key to prepare the scale for the next ingredient. The weight of the ingredient will be tared and stored ...

INNOVATION ON THE MOVE.

INNOVATION ON THE MOVE

X FAC TOR MOBILIZE YOUR PRODUCTIVITY. The DRX-Revolution will improve your work?ow and boost your productivity. It begins with a simple, single card