Natural Biocides To Prevent The Microbial Growth On -Books Pdf

Natural biocides to prevent the microbial growth on
03 Dec 2019 | 26 views | 0 downloads | 8 Pages | 628.14 KB

Share Pdf : Natural Biocides To Prevent The Microbial Growth On

Download and Preview : Natural Biocides To Prevent The Microbial Growth On


Report CopyRight/DMCA Form For : Natural Biocides To Prevent The Microbial Growth On



Transcription

Built Heritage 2013 Monitoring Conservation Management. an homogeneous removal of the surface deposits and preserved the patina. noble under the black crust Whereas bio treatments converted gypsum to. calcite allowing further surface consolidation of marble chemical treatments. formed undesirable sodium sulfate, The goal of this work was to test natural bio cleaning products that could be. not harmful to human health with a low environmental impact highly selective. and at low cost, The antagonist capability of Burkholderia gladioli pv agaricicola ICMP 11096. strain Bga and bio activity of filtrate Bga culture broth cell free and of gly. coalkaloids extracted from Solanaceae were tested against a panel of micro. organisms isolated from two bridges located in Potenza and in Campomag. giore Southern of Italy Fig 1, Burkholderia gladioli aerobic gram negative rod shaped bacterium has the. ability to produce in vitro secondary metabolites with relevant biological activi. ties that may have potential practical applications Elshafie et al 2012. Glycoalkaloids are important bioactive secondary metabolites commonly. found in Solanaceae plants They have anti bacterial and anti fungal activity. Ventrella et al 2012,1 Materials and Methods,1 1 Sampling isolation and growth conditions. Samples 22 from stones of San Vito bridge and 9 from Della Vecchia bridge. were taken by carefully scraping off material with sterile swabs and scalpel. in according to the Italian Cultural Heritage Ministry Recommendation 3 80. and were re suspended in saline solution buffer 0 85 NaCl Samples were. duplicate and isolated by spread plating on PCA medium For each sample. different colonies were selected and purified by streaking on PCA added with. tetracycline hydrochloride 0 005 g L for fungi growth and on PCA added. with cicloxiamide 70 100 mg L for bacteria growth Colonies were used to. test morphology Gram reaction and catalase Isolates were routinely cultiva. ted in PCB and maintained frozen 80 C in skim milk. 1 2 DNA extraction, The total DNA was extracted from bacterial isolates by using the Marmur me.
thod 1961 modified The total DNA was extracted from fungal isolates by. Fig 1 San Vito bridge in Potenza a and Della Vecchia bridge in Campomaggiore b. Built Heritage 2013 Monitoring Conservation Management. using the Raeder Broda method 1985 modified 25 ng of DNA were used. for PCR amplification,1 3 16S rDNA amplification and sequencing. Synthetic oligonucleotide primers fD1 AGAGTTTGATCCTGGCTCAG and. rD1 AAGGAGGTGATCCAGCC were used to amplify the 16S rDNA PCR. mixture and PCR amplification conditions were performed as previously re. ported Bonomo et al 2008 The PCR products were sequenced and DNA. similarity was performed with the Gene Bank and EMBL database The Gene. Bank accession numbers of the sequences are reported in Table 1. 1 4 Internal transcribed spacer ITS region amplification. As described previously White et al 1990 primers ITS1 and ITS4 were used. to amplify specific ITS regions of fungal ribosomal genes PCR mixture and. amplification conditions were performed as described by White et al 1990. The PCR products were sequenced and DNA similarity was performed with. the Gene Bank and EMBL database,1 5 Antibacterial assay. Burkholderia gladioli pv agaricicola ICMP11096 Bga obtained from Interna. tional Collection of Microorganisms from Plant ICMP was used as reference. strain and grown in King Agar B KB medium for 24 h at 30 C. The antibacterial activity of Bga and cell free filtrates of Bga was tested against. all bacterial isolates by agar well diffusion method The cell free filtrate of Bga. was obtained by inoculum of 150 mL of liquid minimal mineral medium MM. with 1 5 mL of bacterial suspension and after incubation at 30 C for 5 days. the culture was filtered Millipore 0 20 m Elshafie et al 2012. Moreover the antimicrobial activity of glycoalkaloids was also evaluated Gly. coalkaloids were obtained by unripe berries of Solanum nigrum European. Black Nightshade and extracted by the method of Cataldi et al 2005 The. extract was lyophilized and re suspended in water to obtain the stock solution. of solamargine principal component at concentration of 500 M The agar. media were inoculated with 60 L of glycoalkaloids solution or Bga culture. broth or cell free filtrates of Bga and after incubation for 3 days at 30 C the. inhibition zone diameters were measured in cm,1 6 Antifungal assay. The antifungal activity of Bga and cell free filtrates of Bga was evaluated by. diffusion method Either Bga culture broth or cell free filtrate of Bga was ino. culated in PCA plates containing 1 cm2 of fungal disc After 4 5 days of incu. bation at 30 C the diameter of fungal colonies were scored and measured in. The fungitoxicity was expressed as percentage of growth inhibition PGI and. calculated according to Zygaldo et al 1994 formula. PGI 100 Gc Gt Gc, where Gc represents the average diameter of fungi grown in PCA control Gt. represents the average diameter of fungi cultivated on the treated PCA dish. Built Heritage 2013 Monitoring Conservation Management. containing the antagonistic bacteria or filtrate,2 Results and Discussion.
2 1 Identified microorganisms, On the basis of amplification and partial sequencing of 16S rDNA the bac. terial strains were grouped in 21 different species belonged to genera within. Proteobacteria Firmicutes and Actinobacteria phyla Table 1 describes the. bacterial strains studied the molecular identification and the Gene Bank ac. cession numbers of sequences, Fungi isolated on the two bridges belonged to Aspergillus Penicillium Fusa. rium Coprinellus and Stemphylium genera,2 2 Inhibition activity. The ability of Bga cell free filtrate of Bga and glycoalkaloid extracts to inhibit. the growth of bacteria and fungi isolated on the two bridges was evaluated in. this study, Results Fig 2 proved that glycoalkaloids extracts were able to inhibit the. growth of all bacterial isolates while Bga showed an high inhibition ability. against Planococcus psychrotoleratus growth Cell free filtrate of Bga inhi. bited the growth of Planococcus psychrotoleratus Exiguobacterium undae. Exiguobacterium acetylicum Exiguobacterium sibiricum and Bacillus cereus. As shown in Figure 3 Bga culture confirmed a higher antifungal activity than. the cell free filtrate of Bga The highest percentage of inhibition of Bga against. fungal growth was observed versus Penicillium spp 75 The inhibition sca. le was Penicillium Stemphylium vesicarium Coprinellus Aspergillus. Solanaceae extracts tested against Fusarium genus showed a low activity. confirming results obtained by other researchers Ventrella et al 2012 Tests. against other fungal colonies isolated from the bridges are in progress. Conclusion, The coexistence of bacterial and fungal species on the stones means that the.
microorganisms interact each other through a series of complex mechanisms. Their presence can cause biodeterioration phenomena on the stone surfaces. due to the formation of patinas and biofilms in which either phototropic micro. organisms or chemorganotrophic bacteria could prevail. Glycoalkaloids extracts inhibited all bacterial strains tested while the Bga. broth and the cell free filtrate resulted more selective especially against bac. teria belonging to Firmicutes phylum Antifungal activity was less evident pro. bably this is due to the structural complexity of fungi. The high activity of glycoalkaloids confirmed results obtained by other rese. archers that tested for agricultural purposes the repulsive or toxic effects of. theses substances on some insects such as the coleoptera Leptinotarsa de. cemlineata and Agriotes obscurus Jonasson and Olsson 1994 Sinden et al. 1980 1986 Marciniak P et al 2009 reported that the application of glyco. alkaloids on the continuously perfused Z atratus heart inhibited progressively. frequency contractions higher concentrations exerted short and reversible. cardiac arrests, Built Heritage 2013 Monitoring Conservation Management. Table 1 Molecular identification of bacterial strains isolated from the two bridges. The application of glycoalkaloids and metabolites of Bulkolderia on cultural. heritage could be an innovative challenge and a viable alternative to synthetic. biocides for the preservation of cultural heritage. Fig 2 Antibacterial activity of glycoalkaloids Bga and cell free filtrate of Bga. Built Heritage 2013 Monitoring Conservation Management. Fig 3 Antifungal activity of Bga culture and cell free filtrate of Bga. The use of these innovative tools can favour the maintenance of the dynamic. ecosystem equilibrium allowing the implementation of non invasive treatment. References, Bonomo M G Ricciardi A Zotta T Parente E Salzano G 2008 Molecular and tech. nological characterization of lactic acid bacteria from traditional fermented sausages of. Basilicata region Southern Italy Meat Science 80 1238 1248. Cappitelli F Toniolo L Sansonetti A Gulotta D Ranalli G Zanardin E C Sorlini. 2007 Advantages of Using Microbial Technology over Traditional Chemical Technolo. gy in Removal of Black Crusts from Stone Surfaces of Historical Monumentws Appl. Environ Microbiol 73 17 5671 5675, Cataldi T R I Lelario F Bufo S A 2005 Analysis of tomato glycoalkaloids by liquid. chromatography coupled with electrospray ionization tandem mass spectrometry. Rapid Comm Mass Spectrom 19 21 3103 3110, Elshafie H S Camele I Racioppi R Scrano L Iacobellis N S Bufo S A 2012 In. Vitro antifungal activity of Burkholderia gladioli pv agaricicola against some phytopa. thogenic fungi Intern J of Mol Sci 13 16291 16302, Gauri L K Parks L Jaynes J R Atlas 1992 Removal of sulphated crust from.
marble using sulphate reducing bacteria Stone Conservation An Overview of Current. Research Second Edition Eric Doehne and Clifford A 160 165. Jonasson T Olsson K 1994 The influence of glycoalkaloids chlorogenic acid and. sugars on the susceptibility of potato to wireworm Potato Res 37 205 216. Marciniak P Adamski Z Bednarz P Slocinska M Ziemnicki K Lelario F Scrano L. Bufo SA 2010 Cardioinhibitory properties of potato glycoalkaloids in beetles Bull. Environ Contam Toxicol Feb 84 2 153 6, Marmur 1961 A procedure for the isolation of deoxyribonucleic acid from micro orga. nism J Mol Biol 3 208 18, Morton L H G Surman S B 1994 Biofilms in Biodeterioration a Review Int Biode. terior Biodegrad 37 203 221, Built Heritage 2013 Monitoring Conservation Management. Normal 3 80 1980 Materiali Lapidei Campionamento CNR ICR Roma. Ranalli G Chiavarini M Guidetti V Marsala F Matteini M Zanardini E C Sorlini. 1997 The use of microorganisms for the removal of sulphates on artistic stoneworks. Int Biodeterior Biodegrad 40 255 261, Ranalli G Zanardini E Pasini P Rota A 2003 Rapid biodeteriogen and biocide dia. gnosis on artworks a bioluminescent low light imaging technique Ann Microbiol. Ranalli G Alfano G Belli C Lustrato G Colombini M P Bonaduce I Zanardini. E Abbruscato P Cappitelli F Sorlini C 2005 Biotechnology applied to cultural he. ritage biorestoration of frescoes using viable bacterial cells and enzymes J Appl. Microbiol 96 73 83, Raeder U Broda P 1985 Rapid preparation of DNA from filamentous fungi Letters.
in Applied Microbiology 1 17 20, Rinaldi A 2006 Saving a fragile legacy Embo reports 7 11 1075 1079. Robin G M ed 1992 Stone cleaning and the nature soiling and decay mechani. sms of stone Proceedings of the International Conference 14 to 16 April 1992 Don. head Publishing Ltd Webster Edinburgh United Kingdom. Sanchez Moral S Luque L Canaveras J C Laiz L Jurado V Hermosin B Saiz. Jimenez C 2004 Bioinduced barium precipitation in St Callixtus and Domitilla cata. combs Ann Microbiol 53 1 12, Sinden S L Sanford L L Osman S F 1980 Glycoalkaloids and resistance to the. Colorado potato beetle in Solanum chacoense Bitter Am Potato J 57 331 343. Sinden S L Sanford L L Cantelo W W Deahl K L 1986 Leptine glycoalkaloids. and resistance to the Colorado potato beetle Coleoptera Chrysomelidae in Solanum. chacoense Environ Entomol 15 1057 1062, Suihko M L Alakomi H L Gorbushina A Fortune I Marquardt J Saarela M 2007. Characterization of aerobic bacterial and fungal microbiota on surfaces of historic. Scottish monuments Syst and Appl Microbiol 30 494 508. Ventrella E Zbigniew A Ewa C Mariola M K Scrano L Bufo S A 2012 Seconda. ry metabolities versus synthetic chemical pesticides towards a better future Procee. ding of 7th European conference on pesticides and related organic micropollutants in. the environment Porto Portugal 7 10 October, Zygadlo J A Guzman C A Grosso N R 1994 Antifungal properties of the leaf oils of. Tagetes minuta L T filifolia Lag J Essent Oil Res 6 617 621. Warscheid Th Braams J 2000 Biodeterioration of stone a review Int Biodeterior. Biodegrad 46 343 368, White T J Bruns T Lee S Taylor J in Innis A Gelfand D H and Sninsky J J.
eds A 1990 Amplification and direct sequencing of fungal ribosomal RNA genes. for phylogenetics PCR Protocols Academic Press San Diego USpp 315 322. Many historic cultural and artistic objects and buildings are made of stone Like all. materials stone is subject to inexorable deterioration Along with chemical and physi. cal weathering factors microbial growth plays an important role in this process Stone. types and local climatic differences have a great impact on the bio deterioration pro. cess and on their outcomes, Microbial metabolism products as organic and inorganic acid chelating agents en. zymes and extracellular polymeric substances EPS are responsible of bio corrosion. and of bio mineralization furthermore phototropic and heterotrophic microorganisms. e g Actinobacteria Firmicutes and fungi are able to penetrate into stone surface In. Built Heritage 2013 Monitoring Conservation Management. addition to structural injure these microorganisms cause also aesthetic damage. The aim of this work was to research products as natural biocides against deteriogen. microorganisms Secondary metabolites from Solanaceae extracts glycoalkaloids. Burkholderia gladioli pv agaricicola Bga ICMP 11096 strain and Bga cell free filtrate. were tested vs a panel of microorganisms isolated from two bridges located in Po. tenza and in Campomaggiore Southern of Italy Artstone isolated bacteria belong. to Proteobacteria Firmicutes and Actinobacteria while fungi belong to Aspergillus. Penicillium Coprinellus and Stemphylium genera, Glycoalkaloids Bga and cell filtrate inhibited the growth of stone colonizing microorga. nisms confirming that the application of natural biocides could be a promising alterna.

Related Books

Cisco Workload Automation BusinessObjects Data Services ...

Cisco Workload Automation BusinessObjects Data Services

Cisco Workload Automation BusinessObjects Data Services Adapter Guide Version 6.3 First Published: August, 2015 Last Updated: September 6, 2016 . 2 THE SPECIFICATIONS AND INFORMATION REGARDING THE PRODUCTS IN THIS MANUAL ARE SUBJECT TO CHANGE WITHOUT NOTICE. ALL STATEMENTS, INFORMATION, AND RECOMMENDATIONS IN THIS MANUAL ARE BELIEVED TO BE ACCURATE BUT ARE PRESENTED WITHOUT WARRANTY OF ANY ...

Metrics for New Product Development - RED HOUSE

Metrics for New Product Development RED HOUSE

Metrics for New Product Development Jonathan Propp PMI Silicon Valley/San Francisco Chapters August 18, 2010

Fatty acid separation of siliceous carbonate phosphates

Fatty acid separation of siliceous carbonate phosphates

Fatty acid separation of siliceous carbonate phosphates J. Hanna and I. Anazia Abstract-The University ofAlabama Mineral Resources Institute (MRI) has developed a unique process for selective fatty acid flotation of carbonate gangue from sedimentary apatites Cfrancolite) in the pH range of 4-6 without collector conditioning of the pulp. The ...

application form Business First - Etisalat

application form Business First Etisalat

Nokia 3 43 22 Nokia 5 56 29 Nokia 6 68 35 Nokia 6 Arte Black 85 44 Nokia 8 145 74 Blackberry KeyOne 170 87 BlackBerry DTEK 60 170 87 BlackBerry Krypton (Motion) 145 74 Huawei P20 Pro 243 124 Huawei Mate 10 196 100 Huawei Mate 10 Pro 255 130 Xiaomi Mi 5 115 60 Xiaomi Redmi 4X 47 25 Xiaomi Redmi NOTE 4 57 29 Xiaomi Mi 5S 107 55 Xiaomi Mi 5S Plus ...

Optimal Income Taxation: Mirrlees Meets Ramsey

Optimal Income Taxation Mirrlees Meets Ramsey

be consistent with the amount of redistribution embedded in the U.S. tax code. We now discuss these two innovations in more detail. The existing literature mostly abstracts from private insurance, but for the purposes of provid-ing concrete practical advice on tax system design it is very important to appropriately specify the

Fire Alarm Systems. - Heliks

Fire Alarm Systems Heliks

General hints y Integral 4 Product Catalogue Fire Alarm Systems 2009 y V 1.0 B-HB-004EN 1 General hints This product catalogue describes the most important components ...

Eastern Trade of the Roman Empire based on Pliny the Elder ...

Eastern Trade of the Roman Empire based on Pliny the Elder

the Roman Empire Th. e fact tha tht e age of Pliny the Elder th, e 1st century A . D. was the great ag e of long-distanc trade ien the Roman Empir contributee tdo my choice. Severa eventl osf the 1st century B . C. stimulate thd e increas ien oriental trade. Hippalu discoveres th monsooed windn characteristis o thf Indiaec n Ocean.

kelas11 sej imtam - KTSP 2006 & Buku Literasi Sekolah

kelas11 sej imtam KTSP 2006 amp Buku Literasi Sekolah

/ Penulis Imtam Rus Ernawati, Nur Siwi Ismawati ; Editor Dwi Ratna Nurhajarini ; Ilustrator Suhardi. -- Jakarta : Pusat Perbukuan, Departemen Pendidikan nasional, 2009. vii, 98 hlm. : ilus. ; 28 cm. Bibliografi : hlm. 98 Indeks : hlm. 95 ISBN 978-979-068-061-6 nomor jilid lengkap) ISBN 978-979-068-070-8 1. Indonesia-Sejarah-Studi dan Pengajaran I. Judul II. Nur Siwi Ismawati III. Dwi Ratna ...

Mortgage-Backed Securities and the Financial Crisis of ...

Mortgage Backed Securities and the Financial Crisis of

Mortgage-Backed Securities and the Financial Crisis of 2008: a Post Mortem Juan Ospina University of Chicago Harald Uhlig University of Chicago First draft: January 21st, 2016 This revision: January 8, 2017 VERY PRELMINARY COMMENTS WELCOME Abstract We examine the payo performance, up to the end of 2013, of non-agency residential mortgage-backed securities (RMBS), issued up to 2008. For our ...

Schrack Seconet Brandmeldesysteme - ingkomora.me

Schrack Seconet Brandmeldesysteme ingkomora me

B-PPT-.0 Schrack Seconet Fire Alarm Systems. CUBUS technology New standards in detection Integral LAN Examples and references Integral IP family