Natural Biocides To Prevent The Microbial Growth On -Books Pdf

Natural biocides to prevent the microbial growth on

2019 | 1 views | 0 downloads | 8 Pages | 628.14 KB

preventive conservation of artworks. This has allowed in a few years to greatly expand the knowledge on the complex interactions between microorganisms and the cultural heritage with the aim to understand the role that individual organisms play within the microbial community and in both processes of bio-deterioration and bio-remediation.




Built Heritage 2013 Monitoring Conservation Management
an homogeneous removal of the surface deposits and preserved the patina
noble under the black crust Whereas bio treatments converted gypsum to
calcite allowing further surface consolidation of marble chemical treatments
formed undesirable sodium sulfate
The goal of this work was to test natural bio cleaning products that could be
not harmful to human health with a low environmental impact highly selective
and at low cost
The antagonist capability of Burkholderia gladioli pv agaricicola ICMP 11096
strain Bga and bio activity of filtrate Bga culture broth cell free and of gly
coalkaloids extracted from Solanaceae were tested against a panel of micro
organisms isolated from two bridges located in Potenza and in Campomag
giore Southern of Italy Fig 1
Burkholderia gladioli aerobic gram negative rod shaped bacterium has the
ability to produce in vitro secondary metabolites with relevant biological activi
ties that may have potential practical applications Elshafie et al 2012
Glycoalkaloids are important bioactive secondary metabolites commonly
found in Solanaceae plants They have anti bacterial and anti fungal activity
Ventrella et al 2012
1 Materials and Methods
1 1 Sampling isolation and growth conditions
Samples 22 from stones of San Vito bridge and 9 from Della Vecchia bridge
were taken by carefully scraping off material with sterile swabs and scalpel
in according to the Italian Cultural Heritage Ministry Recommendation 3 80
and were re suspended in saline solution buffer 0 85 NaCl Samples were
duplicate and isolated by spread plating on PCA medium For each sample
different colonies were selected and purified by streaking on PCA added with
tetracycline hydrochloride 0 005 g L for fungi growth and on PCA added
with cicloxiamide 70 100 mg L for bacteria growth Colonies were used to
test morphology Gram reaction and catalase Isolates were routinely cultiva
ted in PCB and maintained frozen 80 C in skim milk
1 2 DNA extraction
The total DNA was extracted from bacterial isolates by using the Marmur me
thod 1961 modified The total DNA was extracted from fungal isolates by
Fig 1 San Vito bridge in Potenza a and Della Vecchia bridge in Campomaggiore b
Built Heritage 2013 Monitoring Conservation Management
using the Raeder Broda method 1985 modified 25 ng of DNA were used
for PCR amplification
1 3 16S rDNA amplification and sequencing
Synthetic oligonucleotide primers fD1 AGAGTTTGATCCTGGCTCAG and
rD1 AAGGAGGTGATCCAGCC were used to amplify the 16S rDNA PCR
mixture and PCR amplification conditions were performed as previously re
ported Bonomo et al 2008 The PCR products were sequenced and DNA
similarity was performed with the Gene Bank and EMBL database The Gene
Bank accession numbers of the sequences are reported in Table 1
1 4 Internal transcribed spacer ITS region amplification
As described previously White et al 1990 primers ITS1 and ITS4 were used
to amplify specific ITS regions of fungal ribosomal genes PCR mixture and
amplification conditions were performed as described by White et al 1990
The PCR products were sequenced and DNA similarity was performed with
the Gene Bank and EMBL database
1 5 Antibacterial assay
Burkholderia gladioli pv agaricicola ICMP11096 Bga obtained from Interna
tional Collection of Microorganisms from Plant ICMP was used as reference
strain and grown in King Agar B KB medium for 24 h at 30 C
The antibacterial activity of Bga and cell free filtrates of Bga was tested against
all bacterial isolates by agar well diffusion method The cell free filtrate of Bga
was obtained by inoculum of 150 mL of liquid minimal mineral medium MM
with 1 5 mL of bacterial suspension and after incubation at 30 C for 5 days
the culture was filtered Millipore 0 20 m Elshafie et al 2012
Moreover the antimicrobial activity of glycoalkaloids was also evaluated Gly
coalkaloids were obtained by unripe berries of Solanum nigrum European
Black Nightshade and extracted by the method of Cataldi et al 2005 The
extract was lyophilized and re suspended in water to obtain the stock solution
of solamargine principal component at concentration of 500 M The agar
media were inoculated with 60 L of glycoalkaloids solution or Bga culture
broth or cell free filtrates of Bga and after incubation for 3 days at 30 C the
inhibition zone diameters were measured in cm
1 6 Antifungal assay
The antifungal activity of Bga and cell free filtrates of Bga was evaluated by
diffusion method Either Bga culture broth or cell free filtrate of Bga was ino
culated in PCA plates containing 1 cm2 of fungal disc After 4 5 days of incu
bation at 30 C the diameter of fungal colonies were scored and measured in
The fungitoxicity was expressed as percentage of growth inhibition PGI and
calculated according to Zygaldo et al 1994 formula
PGI 100 Gc Gt Gc
where Gc represents the average diameter of fungi grown in PCA control Gt
represents the average diameter of fungi cultivated on the treated PCA dish
Built Heritage 2013 Monitoring Conservation Management
containing the antagonistic bacteria or filtrate
2 Results and Discussion
2 1 Identified microorganisms
On the basis of amplification and partial sequencing of 16S rDNA the bac
terial strains were grouped in 21 different species belonged to genera within
Proteobacteria Firmicutes and Actinobacteria phyla Table 1 describes the
bacterial strains studied the molecular identification and the Gene Bank ac
cession numbers of sequences
Fungi isolated on the two bridges belonged to Aspergillus Penicillium Fusa
rium Coprinellus and Stemphylium genera
2 2 Inhibition activity
The ability of Bga cell free filtrate of Bga and glycoalkaloid extracts to inhibit
the growth of bacteria and fungi isolated on the two bridges was evaluated in
this study
Results Fig 2 proved that glycoalkaloids extracts were able to inhibit the
growth of all bacterial isolates while Bga showed an high inhibition ability
against Planococcus psychrotoleratus growth Cell free filtrate of Bga inhi
bited the growth of Planococcus psychrotoleratus Exiguobacterium undae
Exiguobacterium acetylicum Exiguobacterium sibiricum and Bacillus cereus
As shown in Figure 3 Bga culture confirmed a higher antifungal activity than
the cell free filtrate of Bga The highest percentage of inhibition of Bga against
fungal growth was observed versus Penicillium spp 75 The inhibition sca
le was Penicillium Stemphylium vesicarium Coprinellus Aspergillus
Solanaceae extracts tested against Fusarium genus showed a low activity
confirming results obtained by other researchers Ventrella et al 2012 Tests
against other fungal colonies isolated from the bridges are in progress
Conclusion
The coexistence of bacterial and fungal species on the stones means that the
microorganisms interact each other through a series of complex mechanisms
Their presence can cause biodeterioration phenomena on the stone surfaces
due to the formation of patinas and biofilms in which either phototropic micro
organisms or chemorganotrophic bacteria could prevail
Glycoalkaloids extracts inhibited all bacterial strains tested while the Bga
broth and the cell free filtrate resulted more selective especially against bac
teria belonging to Firmicutes phylum Antifungal activity was less evident pro
bably this is due to the structural complexity of fungi
The high activity of glycoalkaloids confirmed results obtained by other rese
archers that tested for agricultural purposes the repulsive or toxic effects of
theses substances on some insects such as the coleoptera Leptinotarsa de
cemlineata and Agriotes obscurus Jonasson and Olsson 1994 Sinden et al
1980 1986 Marciniak P et al 2009 reported that the application of glyco
alkaloids on the continuously perfused Z atratus heart inhibited progressively
frequency contractions higher concentrations exerted short and reversible
cardiac arrests
Built Heritage 2013 Monitoring Conservation Management
Table 1 Molecular identification of bacterial strains isolated from the two bridges
The application of glycoalkaloids and metabolites of Bulkolderia on cultural
heritage could be an innovative challenge and a viable alternative to synthetic
biocides for the preservation of cultural heritage
Fig 2 Antibacterial activity of glycoalkaloids Bga and cell free filtrate of Bga
Built Heritage 2013 Monitoring Conservation Management
Fig 3 Antifungal activity of Bga culture and cell free filtrate of Bga
The use of these innovative tools can favour the maintenance of the dynamic
ecosystem equilibrium allowing the implementation of non invasive treatment
References
Bonomo M G Ricciardi A Zotta T Parente E Salzano G 2008 Molecular and tech
nological characterization of lactic acid bacteria from traditional fermented sausages of
Basilicata region Southern Italy Meat Science 80 1238 1248
Cappitelli F Toniolo L Sansonetti A Gulotta D Ranalli G Zanardin E C Sorlini
2007 Advantages of Using Microbial Technology over Traditional Chemical Technolo
gy in Removal of Black Crusts from Stone Surfaces of Historical Monumentws Appl
Environ Microbiol 73 17 5671 5675
Cataldi T R I Lelario F Bufo S A 2005 Analysis of tomato glycoalkaloids by liquid
chromatography coupled with electrospray ionization tandem mass spectrometry
Rapid Comm Mass Spectrom 19 21 3103 3110
Elshafie H S Camele I Racioppi R Scrano L Iacobellis N S Bufo S A 2012 In
Vitro antifungal activity of Burkholderia gladioli pv agaricicola against some phytopa
thogenic fungi Intern J of Mol Sci 13 16291 16302
Gauri L K Parks L Jaynes J R Atlas 1992 Removal of sulphated crust from
marble using sulphate reducing bacteria Stone Conservation An Overview of Current
Research Second Edition Eric Doehne and Clifford A 160 165
Jonasson T Olsson K 1994 The influence of glycoalkaloids chlorogenic acid and
sugars on the susceptibility of potato to wireworm Potato Res 37 205 216
Marciniak P Adamski Z Bednarz P Slocinska M Ziemnicki K Lelario F Scrano L
Bufo SA 2010 Cardioinhibitory properties of potato glycoalkaloids in beetles Bull
Environ Contam Toxicol Feb 84 2 153 6
Marmur 1961 A procedure for the isolation of deoxyribonucleic acid from micro orga
nism J Mol Biol 3 208 18
Morton L H G Surman S B 1994 Biofilms in Biodeterioration a Review Int Biode
terior Biodegrad 37 203 221
Built Heritage 2013 Monitoring Conservation Management
Normal 3 80 1980 Materiali Lapidei Campionamento CNR ICR Roma
Ranalli G Chiavarini M Guidetti V Marsala F Matteini M Zanardini E C Sorlini
1997 The use of microorganisms for the removal of sulphates on artistic stoneworks
Int Biodeterior Biodegrad 40 255 261
Ranalli G Zanardini E Pasini P Rota A 2003 Rapid biodeteriogen and biocide dia
gnosis on artworks a bioluminescent low light imaging technique Ann Microbiol
Ranalli G Alfano G Belli C Lustrato G Colombini M P Bonaduce I Zanardini
E Abbruscato P Cappitelli F Sorlini C 2005 Biotechnology applied to cultural he
ritage biorestoration of frescoes using viable bacterial cells and enzymes J Appl
Microbiol 96 73 83
Raeder U Broda P 1985 Rapid preparation of DNA from filamentous fungi Letters
in Applied Microbiology 1 17 20
Rinaldi A 2006 Saving a fragile legacy Embo reports 7 11 1075 1079
Robin G M ed 1992 Stone cleaning and the nature soiling and decay mechani
sms of stone Proceedings of the International Conference 14 to 16 April 1992 Don
head Publishing Ltd Webster Edinburgh United Kingdom
Sanchez Moral S Luque L Canaveras J C Laiz L Jurado V Hermosin B Saiz
Jimenez C 2004 Bioinduced barium precipitation in St Callixtus and Domitilla cata
combs Ann Microbiol 53 1 12
Sinden S L Sanford L L Osman S F 1980 Glycoalkaloids and resistance to the
Colorado potato beetle in Solanum chacoense Bitter Am Potato J 57 331 343
Sinden S L Sanford L L Cantelo W W Deahl K L 1986 Leptine glycoalkaloids
and resistance to the Colorado potato beetle Coleoptera Chrysomelidae in Solanum
chacoense Environ Entomol 15 1057 1062
Suihko M L Alakomi H L Gorbushina A Fortune I Marquardt J Saarela M 2007
Characterization of aerobic bacterial and fungal microbiota on surfaces of historic
Scottish monuments Syst and Appl Microbiol 30 494 508
Ventrella E Zbigniew A Ewa C Mariola M K Scrano L Bufo S A 2012 Seconda
ry metabolities versus synthetic chemical pesticides towards a better future Procee
ding of 7th European conference on pesticides and related organic micropollutants in
the environment Porto Portugal 7 10 October
Zygadlo J A Guzman C A Grosso N R 1994 Antifungal properties of the leaf oils of
Tagetes minuta L T filifolia Lag J Essent Oil Res 6 617 621
Warscheid Th Braams J 2000 Biodeterioration of stone a review Int Biodeterior
Biodegrad 46 343 368
White T J Bruns T Lee S Taylor J in Innis A Gelfand D H and Sninsky J J
eds A 1990 Amplification and direct sequencing of fungal ribosomal RNA genes
for phylogenetics PCR Protocols Academic Press San Diego USpp 315 322
Many historic cultural and artistic objects and buildings are made of stone Like all
materials stone is subject to inexorable deterioration Along with chemical and physi
cal weathering factors microbial growth plays an important role in this process Stone
types and local climatic differences have a great impact on the bio deterioration pro
cess and on their outcomes
Microbial metabolism products as organic and inorganic acid chelating agents en
zymes and extracellular polymeric substances EPS are responsible of bio corrosion
and of bio mineralization furthermore phototropic and heterotrophic microorganisms
e g Actinobacteria Firmicutes and fungi are able to penetrate into stone surface In
Built Heritage 2013 Monitoring Conservation Management
addition to structural injure these microorganisms cause also aesthetic damage
The aim of this work was to research products as natural biocides against deteriogen
microorganisms Secondary metabolites from Solanaceae extracts glycoalkaloids
Burkholderia gladioli pv agaricicola Bga ICMP 11096 strain and Bga cell free filtrate
were tested vs a panel of microorganisms isolated from two bridges located in Po
tenza and in Campomaggiore Southern of Italy Artstone isolated bacteria belong
to Proteobacteria Firmicutes and Actinobacteria while fungi belong to Aspergillus
Penicillium Coprinellus and Stemphylium genera
Glycoalkaloids Bga and cell filtrate inhibited the growth of stone colonizing microorga
nisms confirming that the application of natural biocides could be a promising alterna
tive to synthetic biocides


Related Books

Unity and Coherence in Paragraphs

Unity and Coherence in Paragraphs

paragraph has unity, all of the sentences in it relate to the topic and develop the controlling idea. If a topic sentence states that a paragraph will be about how to prepare for a successful job interview, all sentences in the paragraph should talk about job interview preparation. Adding sentences about how to

2019 BRAND IDENTITY c

2019 BRAND IDENTITY c

A yellow swoosh line will separate the logo from the Event Name. If space allows, an arrow will point from the logo to the Event Name. The teal blob will always include the sponsor name and Event Name with location in smaller type below. The date and time will live in a circle located in or near the teal gradient blob.

Legal Aspects of Business - jnujprdistance.com

Legal Aspects of Business jnujprdistance com

Legal Aspects of Business This book is a part of the course by Jaipur National University , Jaipur. This book contains the course content for Legal Aspects of Business.

BHARATHIDASAN UNIVERSITY

BHARATHIDASAN UNIVERSITY

5. Legal aspects of Business by Akhileshwar Pathak. Tata Mcgraw Hill. 6. Legal aspects of Business by kubendran. Suggested Readings 1. Law of Business contracts in India by Sairam Bhat, Sage, www. sagepublications.com 2. Company law, Ashok K Bagrial Vikas publishing House. 3.Business Law, chandra Bose, PHI learning India PVT Ltd.

A perspective on joint venture: an international business ...

A perspective on joint venture an international business

legal framework governing the various aspects of a Joint Venture in India in brief, the methods of Joint Ventures, as well as RBI regulations on the topic. The research methodology adopted is largely analytical and descriptive. Reliance has been placed largely on various sources like articles and online articles. Keywords: joint venture, business strategies, expansion of business, types of ...

AKUNTANSI PAJAK PENGHASILAN - ocw.ui.ac.id

AKUNTANSI PAJAK PENGHASILAN ocw ui ac id

Akuntansi pajak penghasilan Fokus pada pajak penghasilan perusahaan Sebelum PSAK 46: Beban pajak dalam laporan laba rugi adalah pajak terutang menurut fiskal PSAK ETAP PSAK 46 (eff 1 Jan 1999 perusahaan listed dan 1 Jan 2001 non listed) Beban pajak kini pajak terutang menurut fiskal Beban / penghasilan pajak tangguhan

n Java GUI Development n www.dzone.com Get More Refcardz!

n Java GUI Development n www dzone com Get More Refcardz

you can use the Standard Widget Toolkit (SWT) from Eclipse. Both approaches share some commonality, but each has its own advantages and methods. This DZone Refcard provides a reference on how to use both technologies; the first half of the Refcard will cover Swing, with SWT forming the second half. brought to you by... JAVA SWING - A HISTORY

KEUANGAN LAPORAN 2017 - bpkp.go.id

KEUANGAN LAPORAN 2017 bpkp go id

Pengawasan Keuangan dan Pembangunan berkewajiban menyelenggarakan akuntansi dan laporan pertanggungjawaban atas pelaksanaan Anggaran Pendapatan dan Belanja Negara dengan menyusun laporan keuangan berupa Laporan Realisasi Anggaran, Neraca, Laporan Operasional, Laporan Perubahan Ekuitas, dan Catatan atas Laporan Keuangan.

???????????????????????????

j55011(h27) ??????????????? ???????????? ?? ??????cispr11 ???????26 ?3 ????????????3 ????????????

EFQM EXCELLENCE MODEL - Quality Scotland

EFQM EXCELLENCE MODEL Quality Scotland

the EFQM Excellence Model allows Managers / Leaders to understand the cause and effect relationships between what their organisation does and the results it achieves. with the support of the RaDaR logic it is possible to make a robust assessment of the degree of excellence of any organisation. the RaDaR logic provides a structured approach to