Isolation Of A Novel Cutinase Homolog With Polyethylene-Books Pdf

Isolation of a Novel Cutinase Homolog with Polyethylene
26 Sep 2020 | 2 views | 0 downloads | 7 Pages | 386.54 KB

Share Pdf : Isolation Of A Novel Cutinase Homolog With Polyethylene

Download and Preview : Isolation Of A Novel Cutinase Homolog With Polyethylene

Report CopyRight/DMCA Form For : Isolation Of A Novel Cutinase Homolog With Polyethylene



Transcription

Novel Cutinase Homolog with PET Degrading Activity. identified the gene encoding a novel cutinase homolog termed 1 0 IPTG isopropyl D thiogalactopyranoside was added to the cul. LC cutinase which shows an amino acid sequence identity of ture medium and cultivation was continued overnight The LC cuti. 57 4 to cutinase from Thermobifida fusca overexpressed it in nase 36 293 derivative termed LC cutinase was purified from the cul. Escherichia coli and purified and characterized the recombinant ture supernatant at 4 C as described below The culture medium was. protein We show that LC cutinase exhibits a PET degrading ac centrifuged at 8 000 g for 30 min to separate the supernatant and cells. tivity and is a potent candidate for applications in various indus The protein in the supernatant was precipitated by the addition of ammo. trial fields especially in the textile industries nium sulfate to 80 of the saturated concentration and then dissolved in. 10 mM Tris HCl pH 7 0 containing 1 mM EDTA and 1 mM dithiothre. This research was conducted by S Sulaiman in partial fulfill. itol DTT The solution was dialyzed against the same buffer overnight. ment of the requirement for a Ph D from Osaka University. and applied to a column 1 0 ml of SP Sepharose GE Healthcare Tokyo. Osaka Japan Japan equilibrated with the same buffer The protein was eluted from the. MATERIALS AND METHODS column by linearly increasing the NaCl concentration from 0 to 1 0 M at. 0 2 M NaCl The fractions containing the protein were collected and ap. Cells plasmids and enzymes E coli BL21 CodonPlus DE3 RP F. plied to a Hi Load 16 60 Superdex 200 Prep Grade column GE Health. Downloaded from http aem asm org on September 25 2020 by guest. ompT hsdS rB mB dcm Tetr gal DE3 endA Hte argU proL Camr. care equilibrated with 10 mM Tris HCl pH 7 0 containing 1 mM. was obtained from Stratagene La Jolla CA Plasmid pET25b was pur. EDTA 1 mM DTT and 0 2 M NaCl, chased from Novagen Madison WI E coli BL21 CodonPlus DE3 RP. transformants were grown in lysogeny broth LB medium 10 g of tryp The production level of the protein in E coli cells and the purity of the. tone 5 g of yeast extract and 10 g of NaCl in 1 liter of H2O supplemented protein were analyzed by sodium dodecyl sulfate polyacrylamide gel elec. with 50 mg of ampicillin liter 1 Burkholderia cepacia lipase Bc Lip and trophoresis SDS PAGE 20 using a 12 polyacrylamide gel followed. Candida rugosa lipase Cr Lip were kindly donated from Amano En by staining with Coomassie brilliant blue CBB The amount of the pro. zyme Inc Nagoya Japan The specific esterase and lipase activities of tein was estimated from the intensity of the band visualized by CBB stain. these enzymes determined at pH 8 0 and 50 C using pNP butyrate and ing using the Scion Image program The N terminal amino acid sequence. olive oil as a substrate respectively are 0 0083 and 0 50 kat mg for of the protein was determined by a Procise automated sequencer model. Bc Lip and 0 013 and 0 50 kat mg for Cr Lip 491 Applied Biosystems The protein concentration was determined. Construction of DNA library and screening The compost sample from the UV absorption on the basis that the absorbance of a 0 1 1 0. was taken from the core 1 m below the surface of the 4 month old mg ml solution at 280 nm is 1 37 This value was calculated by using. compost made from leaves and branches in EXPO Park Japan The tem 1 526 M 1 cm 1 for tyrosine and 5 225 M 1 cm 1 for tryptophan at 280. perature and pH of this leaf branch compost are 67 C and pH 7 5 DNA nm 15. for metagenomic study was extracted from this compost sample using Construction of mutant protein The pET25b derivative for overpro. ISOIL from Nippon Gene Toyama Japan DNA library for meta duction of S165A cutinase in which the active site serine residue. genomic study was constructed by using a CopyControl fosmid library Ser165 of LC cutinase is replaced by Ala was constructed by PCR using. production kit Epicentre Biotechnologies Madison WI according to the QuikChange II site directed mutagenesis kit Stratagene The muta. the procedures recommended by the supplier This DNA library was genic primers were designed such that the TCG codon for Ser165 is. spread on LB agar plates containing 12 5 g of chloramphenicol ml 1 changed to GCG for Ala The mutant protein was overproduced and pu. tributyrin 0 1 Tween 80 and 0 01 L arabinose and the resultant rified as described above for LC cutinase. plates were incubated at 37 C for several days Plasmids were extracted Circular dichroism spectra The far UV circular dichroism CD. from colonies which form halos around them due to hydrolysis of tribu spectra were measured at 25 C on a J 725 spectropolarimeter Japan Spec. tyrin Genes encoding lipolytic esterolytic enzymes were identified by troscopic Tokyo Japan The protein was dissolved in 10 mM Tris HCl. transposon mutagenesis using EZ Tn5 T7 KAN 2 Promoter insertion pH 7 0 containing 1 mM DTT The protein concentration was 0 1. kit Epicentre Biotechnologies according to the procedures recom mg ml and a cell with an optical path length of 2 mm was used The mean. mended by the supplier The nucleotide sequence of the gene was deter residue ellipticity degrees cm2 dmol 1 was calculated using an average. mined by using an ABI Prism 3100 DNA sequencer Applied Biosystems amino acid molecular mass of 110. Tokyo Japan Oligonucleotides for sequencing as well as PCR primers Enzyme assays The enzymatic activity was determined at the tempera. and mutagenic primers were synthesized by Hokkaido System Science ture indicated in 1 ml of 25 mM Tri HCl pH 8 0 containing 2 acetonitrile. Sapporo Hokkaido Japan, and 1 mM p nitrophenyl butyrate C4 The amount of p nitrophenol pNP. Overproduction and purification The gene encoding LC. released from the substrate was determined from the absorption at 405 nm. cutinase 36 293 residues 36 to 293 of LC cutinase was amplified. with an absorption coefficient of 18 600 M 1 cm 1 by automatic spectropho. by PCR using the fosmid vector harboring the LC cutinase gene. tometer Hitachi spectrophotometer U 2810 Hitachi High Technologies. as a template The sequences of the PCR primers were 5. Tokyo Japan One katal unit of enzymatic activity was defined as the amount. GCGTCGCCATGGATTCCAACCCGTACCAG 3 for the 5 primer and. 5 CAGGATCCACTACTGGCAGTGGCG 3 for the 3 primer underlin of enzyme that produced 1 mol of pNP per s The specific activity was defined. ing indicates the NcoI site for 5 primer and the BamHI site for 3 as the enzymatic activity per milligram of protein. primer The resultant DNA fragment was digested with NcoI and For determination of substrate specificity pNP monoesters of fatty. BamHI and ligated into the NcoI BamHI sites of pET25b to construct acids with acyl chain lengths of 2 pNP acetate 4 pNP butyrate 6. pET LCC for overproduction of the pelB LC cutinase 36 293 fusion pNP hexanoate 8 pNP caprylate 12 pNP laurate 14 pNP. protein This fusion protein was designed such that Met Asp LC myristate 16 pNP palmitate and 18 pNP stearate Sigma and olive. cutinase 36 293 in which the Met Asp sequence is derived from the oil were used as a substrate Measurement of the enzymatic activities for. NcoI site used to insert the LC cutinase 36 293 gene into pET25b is hydrolyses of pNP monoesters of fatty acids was performed as described. secreted to the periplasm with the assistance of the pelB leader se above for hydrolysis of pNP butyrate except that the reaction mixture. quence PCR was performed in 25 cycles with a GeneAmp PCR system contained 25 mM Tris HCl pH 8 0 10 acetonitrile and 1 mM sub. 2400 Applied Biosystems using KOD DNA polymerase Toyobo strate One katal unit of enzymatic activity was defined as the amount of. The nucleotide sequence was confirmed by using an ABI Prism 3100 enzyme that produced 1 mol of pNP per s Measurement of the enzymatic. DNA sequencer Applied Biosystems activity for hydrolysis of olive oil was performed at the temperature indi. E coli BL21 CodonPlus DE3 RP transformants with pET LCC were cated by titrating the liberated fatty acid with 10 mM NaOH as described. cultivated at 37 C When the absorbance of the culture at 600 nm reached previously 2 except that the reaction was carried out in 25 mM Tris HCl. March 2012 Volume 78 Number 5 aem asm org 1557, Sulaiman et al. TABLE 1 Proteins with high amino acid sequence identities to LC cutinase as determined by BLAST searching. Enzyme No of residues Source organism Accession no Identity a. Triacylglycerol lipase 289 Thermomonospora curvata YP 003298899 59 7. Putative lipase 334 Streptomyces ambofaciens CAJ88461 57 8. Cutinase 261 Thermobifida fusca YP 288944 57 4, Lipase 310 Streptomyces coelicolor A3 2 AAD09315 1 57 4. Cutinase 304 Saccharomonospora viridis YP 003134604 55 8. Lipase 304 Streptomyces albus ZP 04702335 1 55 4, Cutinase 290 Nocardiopsis dassonvillei ZP 04331006 1 54 7.
Lipase 262 Streptomyces exfoliatus 1JFR A 53 9, a The amino acid sequence identities of proteins to LC cutinase without putative signal peptide. Downloaded from http aem asm org on September 25 2020 by guest. pH 8 0 One katal unit of enzymatic activity was defined as the amount domly selected clones using BamHI restriction enzymes showed. of enzyme that liberated 1 mol of fatty acid per s nonredundant patterns and an average insert size of 35 kb. Inhibition with E600 LC cutinase 1 0 nmol was incubated at 50 C Screening of the library for genes encoding lipolytic esterolytic. for 30 min in 100 l of 10 mM Tris HCl pH 7 6 containing 5 mM diethyl enzymes was performed using tributyrin agar plates E coli trans. pNP phosphate E600 Sigma The residual activity was determined at formants which gave a halo should contain these genes Of ap. 30 C using pNP butyrate as a substrate, Detection of PCL degrading activity Poly caprolactone PCL. proximately 6 000 clones screened 19 clones gave a halo on tribu. degrading activity was determined by measuring the weight loss of a PCL tyrin agar plates when they were incubated at 37 C for 3 days. film after incubation with the enzyme For preparation of PCL film 20 to Three of them which gave the largest halo at 50 C were chosen to. 30 mg of PCL Wako Pure Chemical Osaka Japan was melted at 80 C determine the nucleotide sequences of the genes responsible for. and pressed into a thin film with 5 mm in diameter at room tempera halo formation Determination of the nucleotide sequences of. ture This PCL film was added into 1 ml of 500 mM Tris HCl pH 8 0 and these genes by transposon mutagenesis indicates that all three. preincubated at 50 C for 5 min The reaction was initiated by the addition clones harbor the same gene encoding a lipolytic esterolytic en. of enzyme 5 g for LC cutinase and 50 g for Bc Lip and Cr Lip and zyme This protein is termed LC cutinase cutinase homolog from. continued at 50 C for 6 h After incubation the films were washed with leaf branch compost LC cutinase is composed of 293 amino. water and ethanol and dried for measurement of the weight loss. acid residues with a calculated molecular mass of 31 494 and an. Detection of PET degrading activity PET degrading activity was de. termined by measuring the weight loss of a PET film after incubation with isoelectric point pI of 9 3. the enzyme For preparation of PET film a plastic package made of PET Amino acid sequence Similarity search using blastp program. was cut into 5 mm2 pieces 20 to 25 mg per piece This PET film was indicates that LC cutinase shows relatively high amino acid se. added into 1 ml of 500 mM Tris HCl pH 8 0 and preincubated at 50 C quence identities of 54 to 60 to lipases which have been classi. for 5 min The reaction was initiated by the addition of enzyme 5 g for fied as family III lipases 7 and cutinases Table 1 It shows the. LC cutinase and 50 g for Bc Lip and Cr Lip and continued at 50 C highest amino acid sequence identity of 59 7 to Thermomono. with gentle shaking for 24 h After incubation the films were washed with spora curvata lipase The amino acid sequence of LC cutinase is. water and ethanol and dried for measurement of the weight loss PET compared to those of Thermobifida fusca cutinase and Streptomy. degrading activity was also determined by quantifying the fatty acids re. ces exfoliatus lipase in Fig S1 in the supplemental material T fusca. leased upon hydrolysis of PET with 50 mM NaOH A PET film was incu. bated with the enzyme as mentioned above except that the concentration. cutinase shows the highest amino acid sequence identity of 57 4. of the reaction buffer was reduced to 100 mM and the incubation time was to LC cutinase among various cutinases and has been biochemi. changed to 12 and 30 h cally characterized as a representative member of bacterial cuti. Detection of cutin degrading activity Cutin fibers were prepared nases 9 S exfoliatus lipase is the only protein listed in Table 1 for. from tomato peels as described previously 23 These fibers 10 mg were which the crystal structure is available 37. added into 1 ml of 20 mM Tris HCl pH 8 0 and preincubated at 50 C for Analysis of the amino acid sequence of LC cutinase using. 5 min The reaction was initiated by the addition of enzyme 50 g for SMART http smart embl de 21 31 suggests that LC cutinase. LC cutinase and 100 g for Bc Lip and Cr Lip and continued at 50 C is a secretory protein and has a 34 residue signal peptide at the N. with gentle shaking At appropriate intervals an aliquot of the reaction terminus The mature region of LC cutinase without this putative. mixture was withdrawn and the fatty acids released upon hydrolysis of. Isolation of a Novel Cutinase Homolog with Polyethylene Terephthalate Degrading Activity from Leaf Branch Compost by Using a Metagenomic Approach Sintawee Sulaiman aSaya Yamato Eiko Kanaya a Joong Jae Kim a Yuichi Koga a Kazufumi Takano a b and Shigenori Kanayaa

Related Books

Nokia C3 00 User Guide AT amp T

Nokia C3 00 User Guide AT amp T

Nokia C3 00 User Guide Issue 1 1 Contents Safety 4 Support 5 Nokia C3 in brief 5 Key features 5 Keys and parts 6 Get started 8 Insert SIM card and battery 8 Switch on or off 9 Antennas 9 Charge the battery 9 Headset 10 Insert a microSD card 10 Remove the microSD card 11 Connect a USB data cable 11 Attach the wrist strap 12 Magnets and magnetic fields 12 Access codes 12 Home screen 13 Keypad

Nokia C3 00 User Guide files customersaas com

Nokia C3 00 User Guide files customersaas com

Nokia C3 00 User Guide Issue 2 Contents Safety 4 Support 5 Nokia C3 in brief 5 Key features 5 Keys and parts 6 Get started 7 Insert SIM card and battery 7 Switch on or off 7 Antennas 7 Charge the battery 8 Headset 8 Insert a microSD card 8 Remove the microSD card 9 Connect a USB data cable 9 Attach the wrist strap 9 Magnets and magnetic fields 10 Access codes 10 Home screen 10 Keypad lock

Nokia C3 00 User Guide nds1 webapps microsoft com

Nokia C3 00 User Guide nds1 webapps microsoft com

Nokia C3 00 User Guide Issue 4 0 Contents Safety 4 Support 5 Nokia C3 in brief 5 Key features 5 Keys and parts 5 Get started 7 Insert SIM card and battery 7 Switch on or off 8 Antennas 8 Charge the battery 8 Headset 8 Insert a microSD card 9 Remove the microSD card 9 Connect a USB data cable 9 Attach the wrist strap 10 Magnets and magnetic fields 10 Access codes 10 Home screen 10 Keypad

Nokia C3 00 User Guide download support webapps

Nokia C3 00 User Guide download support webapps

Nokia C3 00 User Guide Issue 3 1 Contents Safety 4 Support 5 Nokia C3 in brief 5 Key features 5 Keys and parts 6 Get started 8 Insert SIM card and battery 8 Switch on or off 9 Antennas 9 Charge the battery 10 Headset 10 Insert a microSD card 11 Remove the microSD card 12 Connect a USB data cable 12 Attach the wrist strap 13 Access codes 13 PUK codes 13 Home screen 14 Keypad lock 16 Use your

58338 Federal Register Vol 77 No 183 Thursday

58338 Federal Register Vol 77 No 183 Thursday

58338 Federal Register Vol 77 No 183 Thursday September 20 2012 Proposed Rules compliance times specified unless the actions have already been done g Inspection At the later of the times specified in paragraphs g 1 and g 2 of this AD Inspect to identify the part number and serial number of the airplane s forward and aft cargo doors as applicable to MSN in accordance with

5200 Federal Register Vol 83 No 25 Tuesday February 6

5200 Federal Register Vol 83 No 25 Tuesday February 6

5200 Federal Register Vol 83 No 25 Tuesday February 6 2018 Rules and Regulations DEPARTMENT OF DEFENSE Department of the Army Corps of Engineers 33 CFR Part 328 ENVIRONMENTAL PROTECTION AGENCY 40 CFR Parts 110 112 116 117 122 230 232 300 302 and 401 EPA HQ OW 2017 0644 FRL 9974 20 OW RIN 2040 AF80 Definition of Waters of the United States

15068 Federal Register Vol 83 No 68 Monday April 9

15068 Federal Register Vol 83 No 68 Monday April 9

15068 Federal Register Vol 83 No 68 Monday April 9 2018 Rules and Regulations for emergencies The Coast Guard will also inform the users of the waterways through our Local and Broadcast Notices to Mariners of the change in operating schedule for the bridge so vessel operators may arrange their transits to minimize any impact caused by the temporary deviation In accordance with 33 CFR

Federal Register Vol 83 No 153 Wednesday August 8

Federal Register Vol 83 No 153 Wednesday August 8

Federal Register Vol 83 No 153 Wednesday August 8 2018 Proposed Rules 38997 1 As of December 31 2017 within the nine states that allow privately insured credit unions approximately 116 state chartered credit unions are privately insured and are not subject to the NCUA s

Federal Register Vol 84 No 191 Wednesday October 2

Federal Register Vol 84 No 191 Wednesday October 2

52554 Federal Register Vol 84 No 191 Wednesday October 2 2019 Notices action in the Section 301 investigation of China s acts policies and practices related to technology transfer intellectual property and innovation The U S Trade Representative s determination included a decision to establish a product exclusion process

Federal Register Vol 83 No 134 Thursday July 12 2018

Federal Register Vol 83 No 134 Thursday July 12 2018

Federal Register Vol 83 No 134 Thursday July 12 2018 Proposed Rules 32227 1 While EPA administers most provisions in the CWA the Department of the Army Corps of Engineers Corps administers the permitting program under section 404 During the 1980s both agencies adopted substantially similar definitions of

Guide to Writing Your Business Plan BMO Harris Bank

Guide to Writing Your Business Plan BMO Harris Bank

Page 3 of 5 Names of owners Percentage ownership Extent of involvement with the company Forms of ownership i e common stock preferred stock general partner limited partner Outstanding equity equivalents i e options warrants convertible debt Common stock i e authorized or issued Management Profiles Experts agree that one of the strongest factors for success in any growth