Chapter 3 9vlateriacs El 9vletfiods-Books Pdf

Chapter 3 9vlateriaCs el 9vletfiodS
25 May 2020 | 26 views | 0 downloads | 28 Pages | 1.91 MB

Share Pdf : Chapter 3 9vlateriacs El 9vletfiods

Download and Preview : Chapter 3 9vlateriacs El 9vletfiods


Report CopyRight/DMCA Form For : Chapter 3 9vlateriacs El 9vletfiods



Transcription

Materials Methods,3 1 Plant materials, Cicer arietinum Pusa 362 variety kind contribution of Dr. N S Yadav Dept of Genetics IARI New Delhi,Nicotiana tabacum cv SRI. 3 2 Fungal strain used, Ascochyta rabiei isolates were kind contribution of Dr Virendra Singh Dr K D. Srivastava Department of Plant Pathology IARI, Isolate Indian type culture Spore colour I Virulence. collection ITCC No, From Delhi India I T C C No 4611 Pinkish white I Virulent.
3 3 Bacterial strains used,Strain Genotype, Escherichia coli DH5a l 8d1acZ M15 recA1 endA1 gyr A96 thi 1 hsd17 rk mk. supE44 relA1 deoR LaczyA argF U19, Agrobacterium tumefaciens carry pAL4404 Ti plasmid with streptomycin selection and. LBA4404 rifampicin chromosomal selection, Agrobacterium tumefaciens carry pMP90 Ti plasmid with gentamicin selection and rifampicin. GV3101 chromosomal selection,3 4 Strains of Saccharomyces cerevisiae used. Strain Genotype Source, CML235 MATa ura3 52 eu2Dl his3D200 Dr Enrique Herrero.
Universitat de Lleida, MML19 MATa grx5 kanMX4 Deletion in CML235 Dr Enrique Herrero. Universitat de Lleida, CY4 MATa ura3 52leu2 3 112 trp1 1 ade2 1 his3 11 Dr Chris M Grant. can1 100 University of Manchester,Y70 As in strain CY4 but grxl LEU2 As above. YlOO As in strain CY4 butgrx2 HIS3 As above, Yll7 As in strain CY4 butgrxl LEU2 grx2 HIS3 As above. Materials Methods, NMY51 MATa his3delta200 trpl 90lleu2 3112 ade2 DualsystemsBiotech.
LYS2 lex Aop 4 HIS3 ura3 lexAop 8 lacZ Switzerland. lex Aop 8 ADE2 GAL4, NMY61 MATalpha his3delta200 trpl 901leu2 3112 ade2 DualsystemsBiotech. LYS2 lexAop 4 HIS3 ura3 lexAop 8 lacZ Switzerland,lexAop 8 ADE2 GAL4. 3 5 Plasmid vectors used,I Name Source Purpose,pDrive U A vector Qiagen PCR product cloning. pJET2 1 blunt Fermentas Blunt end cloning of PCR product. pYES2 Invitrogen Yeast complementation and expression. pBI121M Modified in lab Binary vector with GFP for localization. pBI121 vector Clontech Binary vector with GUS for,overexpression studies. pENTR D TOPO Invitrogen For Gateway doming, pDHBl Dualsystems Technologies Yeast two hybrid bait cloning vector.
pSUPF 1 2 3 In house modified from pPR3 Yeast two hybrid prey vector for. N in this study recombination mediated cloning of, pPR3 N DualsystemsBiotech Yeast two hybrid prey cloning vector. pAI Alg5 DualsystemsBiotech Bait expression control from DUALhunter. PDL2 Alg5 DualsystemsBiotech Bait expression control from DUALhunter. pDHBl largeT DualsystemsBiotech Positive control for DUALhunter kit. pDSL p53 DualsystemsBiotech Positive control for DUALhunter kit. 3 6 Chemicals and Materials used,Type Material Souree. Nylon Membrane Hybond Amersham,Ampicillin Kanamycin Cefatoxime Sigma. Antibiotics,Qfampicin Spectinomycin,Radioisotopes Amersham BARC. Disposable filters PVDF 0 45 11m filter unit Millipore MDI. Enzymes Commonly used restriction enzymes NEB,Taq DNA Polymerase Clontech F ermentas.
T4 DNA Ligase F ermentas NEB,RNase BioBasic Amersham. Ethidium Bromide Xylene cyanol Amersham,Methylene Blue Coomasie Brilliant Blue. Materials Methods, Culture media Tryptone Yeast Extract Agar MS salts BAP Difco. components NAA PDA, Isopropanol iso amyl alcohol CaClz NaCI NaOH Qualigens HiMedia and. Glucose Methanol MgClz KOH Merck,Potassium acetate Chloroform Glycerol.
Locally available,Acetic acid NaH2P04 Na2HP04 MgS04 HCl. H2S04 Glycine KCl Sucrose Pot Dichromate,Sodium hypochlorite Mercuric chloride tri Sodium. citrate Formaldehyde, RNaseZap DEPC HEPES IPTG MOPS Sephadex Amersham Sigma Ambion. G 50 EDTA CTAB Acrylamide Bis Acrylamide BBI, Foreign chemicals TEMED Spermine Spermidine Polyvinyl. Polypyrollidine,Triton X 100 X gal,3 7 Oligonucleotides used in the present study.
M13For 5 CGCCAGGGTTTTCCCAGTCACGAC 3 Seqencing,M13Rev 5AGCGGATAACAATTTCACACAGGA3 Sequencing. CaGRXRl 5GAACACAGCAGGAACAGGTG3 5 RACE,CaGRXR2 5CATGAACCATAGGCCTAATC3 5 RACE. GRX2REV1 5TTGTAACCAGAATTCCAGCTCCTC3 5 RACE,GRX2REV2 5CAGCTAATGCTCCTTGGATCTCAC3 5 RACE. VARFORl 5AATCAATTAAGTGGATACCTAGGCAC3 3 RACE,VARFOR2 5ATTCACAGGCAGGCAAGAGACAAC3 3 RACE. CaCAXIP5 5GCCAATTGGAATAGTCCTTC3 5 RACE, CaGRXlEF 5CATGCCATGGAGAAAGTGATGAGGTTG3 GFP fusion cloning.
CaGRXlER 5GAAGATCTTCAGATAAAGATTGGTGGTATGGT3 GFP fusion cloning. TpGrxF 5CACCATGGAGAAAGTGATGAGGTTGGC3 GRXl cloning in pENTR. TpGrxR 5 AGAT AAAGATTGGTGGTATGGTTTCAA 3 GRXl cloning in pENTR. ENTRGx3F 5CACCATGGCACTACCAAAGGCAAAGG3 GRX2 cloning in pENTR. ENTRGx3R 5AGAAGTTGACCCAGAAACAGCTCCAG3 GRX2 cloning in pENTR. CXIPMGF 5GCTCTAGAGATCGTGGGTGGAAAATTG3 GFP fusion in pBI121M. CXIPMGR 5ACGCGTCGACAGAGCACATTGCCTTCTCC3 GFP fusion in pBI121M. GRXfF 5 GGAATTCGTTTGGGAGTTCTAAAT AAATC 3 Cloning in A1NE vector. GRXtR 5CGGGATCCGCAAGGATAAATCAAACTTC3 Cloning in A 1NE vector. CXPYF 5CCCAAGCTTAACACAATGTCTTTCAGTTGCTGCG3 GRX3 cloning in p YES2. CXIP121F 5GCTCTAGAATGTCTTTCAGTTGCTGCGT3 GRX3 clonin gin pBI121. CXIP121R 5CGGGATCCTCAAAGAGCACATTGCCTTCTC3 GRX3 cloning in pBI121. GXYF 5CCCAAGCTTAACACAATGGAGAAAGTGATGAGG3 GRX1 cloning in pYES2. YS2GFPF CCCAAGCTTAACACAATGGTAGATCTGACTAGTAAAGGAG GFP inpYES2. YS2GFPR GCTCTAGATCACACGTGGTGGTGGTGGTG3 GFPinpYES2,Materials Methods. NtEFlF 5TACAAGATTGGTGGTATTGGTACT3 Real time control. NtEFlR 5GTTCTTGACGTTGAATCCAACAT3 Real time control. GrxDHBF 5GGCCATTACGGCCATGGAGAAAGTGATGAGGTTG3 GRXl in DHB vector. Grx DHBR 5GGCCATTACGGCCAAAGATAAAGATTGGTGGTATGGTT3 GRXl in DHB vector. YLocGXF 5CGCGGATCCAACACAATGGAGAAAGTGATGAGG3 GRXl in pYES2. Sterilization methods, All the glassware tissue culture tools and culture media were sterilized by autoclaving at. 121 6 C under 15 lb psi pressure for 15 minutes The antibiotics and other heat labile. components were filter sterilized with dispensable syringe driven PVDF filter unit of. 0 22 m pore size Millex Millipore USA, 3 8 Plant growth conditions maintenance and fungal treatment procedures. Plant growth conditions, All the Chickpea Cicer arietinum L varieties used were grown under similar. conditions Seeds were soaked overnight in tap water and sown in soil 3 4 seeds pot in. growth chamber at 25 4 C,Fungal growth conditions, Ascochyta rabiei isolates were routinely grown on sterilized potato dextrose agar PDA.
media supplemented with crushed chickpea seed slants in culture tubes and plates at. room temperature and 12 hours photoperiod The strains were routinely subcultured for. their maintenance The fungus is passed through the plant in order to maintain its. virulence where upon the plants were infected with the fungus and once the disease. symptoms become visible the infected samples were inoculated on PDA to facilitate. fungus growth The culture was subsequently subcultured before using it for fresh. Fungal inoculum preparation and inoculation, For spore collection PDA tubes with fungus grown on the media were filled with sterile. tap water and left for 10 min The surface was rubbed with a sterile loop to suspend the. spores in water The suspension was filtered through muslin cloth The concentration of. spores was determined using haemocytometer and dilutions were made in sterilized tap. water to obtain 106 and 108 spores ml Inoculum was sprayed on 3 weeks old chickpea. Materials Methods, plants until the leaves were completely covered with the suspension To maintain high. humidity conditions pots were covered with a transparent plastic sheet The control. plants were sprayed with sterile tap water and grown under similar conditions Following. inoculation samples were harvested after required time intervals immediately frozen in. liquid nitrogen and stored at 80 C The control samples were also harvested To rule out. any kind of discrepancy on account of variation in infection the samples were randomly. collected in triplicates and mixed RNNprotein were later isolated from randomly mixed. samples Symptoms of fungal growth were regularly monitored Estimation of disease. severity was recorded by a visual assessment of disease symptoms The 108 spores ml. inoculated plants were severely infected and appeared almost bleached after 10 days and. were not able complete their life cycle On the other hand the plants inoculated with 106. spores ml survived infection to complete their life cycle. 3 9 Methods, If not stated the methods employed in this study were taken from Sambrook J et al. eds 1989 Molecular cloning a laboratory manual 2nd ed Cold Spring Harbor NY. Cold Spring Harbor Laboratory Press,3 9 1 Gateway cloning. The Gateway cloning provides an extremely fast and efficient route to clone the gene of. interest in several destination vectors through a common entry clone Its high efficiency. is based on the att recombination sites used by clonase enzyme mix. A Cloning in pENTR vector, The pENTRJ D TOPO cloning kit was used for generating ENTRY clones containing.
desired inserts The direction cloning of purified blunt end PCR product in pENTR. vector was done by incorporating CACC at the 5 end of forward primers The TOPO. cloning reaction was performed as given below,1 The reaction was set up as. Reagent Chemical Transformation,Fresh PCR product 0 5 4 11. Salt solution 1Jll,Water to a final volume of 5Jll. Materials Methods,ITOPO vector, 2 The content was gently mixed and incubated for 30 minutes at room temperature. and placed on ice It was later transformed in NEB5a chemically competent. cells The positive clones were selected on kanamycin 50J 1g ml plate and. confirmed by colony PCR and sequencing The plasmid of this positive clone. was isolated to be used for cloning in any destination vector. B Generation of destination clones, The gene of interest from the entry construct into the Gateway destination vector was.
carried out for generating an expression clone The LR recombination reaction was done. using Gateway LR Clonase II Enzyme Mix,LR reaction. The reaction was set up as follows,Entry clone 50 ng Jll 1 Jll. Destination vector 50 ng Jll 1 Jll,ddH20 1 Ill,LR Clonase II Mix 2 Jll. The reaction was incubated at 25 C for 1 hour and reaction was terminated after. adding Proteinase K solution The reaction was incubated at 37 C for 10 minutes The. reaction product was transformed in bacterial competent cells and plated on. spectinomycin containing plates The positive clones were confirmed by colony PCR. and sequencing,GenomicPCR,3 9 2 General cloning procedures. A Elution of DNA from agarose gel, The PCR product was fractionated on 1 agarose EtBr gel The band was cut by using.
sterile blade and collected in a 1 5 ml sterile micro centrifuge tube The gel elution was. done using MinElute gel extraction kit Qiagen Germany The elution was done. according to the manufacturers instructions with minor modifications Three volumes. one volume of gel 100 mg 100 f l of buffer QG was added to the eppendorf. Materials Methods, containing the gel slice and incubated at 40 C for 30 min to dissolve the agarose After. the gel slice has dissolved completely one gel volume of isopropanol was added and. mixed by inverting the tubes 4 5 times This sample was loaded into the MinElute. column that was kept on a 2ml collection tube and centrifuged at 13 000 rpm for 1 min. The flow through was discarded and the column was again placed in the same collection. tube Further 500 Jll of QG buffer was loaded to the column and centrifuged at 13 000. rpm for 1 min The flow through was discarded and column was again placed in the. same collection tube To wash the column 750 Jll buffer PE was loaded into the column. and centrifuged at 13 000 rpm for 1 min The flow through was discarded and column. was again placed in the same collection tube and centrifuged for an additional 1 min to. remove the residual ethanol The MinElute column was then placed in clean 1 5 ml. micro centrifuge tube To elute the DNA 10 Jll of elution buffer lOOmM TrisCl pH. 8 0 or sterile nuclease free water was loaded directly on the matrix The column was left. as such for 5 min and then centrifuged at 13 000 rpm for 2 min DNA was obtained as. flow through The eluted DNA was stored at 20 C till further use. B Purification of PCR products, The PCR products were purified by using MinElute PCR purification kit Qiagen. Germany Purification was done according to manufacturer s instructions with minor. modifications Five volumes of PB buffer was added to one volume of the PCR reaction. product and mixed The mixture was then applied to the MinElute column that was kept. in 2 ml collection tube and centrifuged at 13 000 rpm for 1 min to bind the DNA to the. membrane flow through was discarded and column was again placed in same collection. tube To wash the column 750 Jll PE buffer was applied to the column and centrifuged at. 13 000 rpm for 1 min The flow through was discarded and column was again placed in. the same collection tube and centrifuged for an additional 1 min to remove the residual. ethanol Now the MinElute column was placed in a clean 1 5 ml microcentrifuge tube. To elute the DNA 10 Jll of elution buffer or sterile nuclease free water was loaded. directly on the matrix The column was left for 5 min and then centrifuged at 13 000 rpm. for 2 min The DNA was obtained as flow through The eluted DNA was stored at 20 C. till further use,Materials Methods,3 9 3 Preparation of Competent Bacterial Cells. For cloning purpose E coli DH5a and related strains were made competent by the. Materials amp Methods I TOPO vector 2 The content was gently mixed and incubated for 30 minutes at room temperature and placed on ice It was later transformed in NEB5a chemically competent cells The positive clones were selected on kanamycin 50J 1g ml plate and

Related Books

Chelsea Green E Galley Not for or Amazon S3

Chelsea Green E Galley Not for or Amazon S3

He has been called the rebel farmer because he won t back down to conventional agricultural systems despite being fined and threatened with prison for practices such as not pruning his fruit trees Holzer conducts permaculture seminars at his farm and worldwide has written several books and is the subject of the film The Agricultural Rebel He works nationally as a permaculture

ZETOR TRACTORS ferguson shop eu

ZETOR TRACTORS ferguson shop eu

Zetor Maxterra range 165 12541 Zetor Proxima range 6421 6441 7421 7441 8421 8441 Zetor Proxima Plus range 8541 9541 10541 Proxima Power range 85 95 105 115 Silver Series range 7020 7040 8020 8040 9020 9040 9050 10050 10050 Plus 11050 11050 Plus 12050 Plus Zetor Crystal Crystal Zetor models

TWIRL Ampersand Inc

TWIRL Ampersand Inc

Twirl s new series of books uses flaps to engage young readers Shapes A Fold a Flap Book Illustrated by Philip Giordano Numbers Children will love to lift the flaps to find out the animals and things that represent the numbers 1 through 10 and even 20 Count ing has never been this much fun Shapes Circles diamonds triangles and more Lift the flaps to find out more about the basic

Turning Heads Shaping Minds since 2014 Ampersand Inc

Turning Heads Shaping Minds since 2014 Ampersand Inc

It s Spring In this season of new beginnings we have many amazing titles to present with themes ranging from pirates and cars to feelings and animal habitats

September New Products

September New Products

September New Products 1 New Products A Lot of Otters Mother Moon is looking for her child As she calls for him her tears turn into stars that fall into the sea and are rescued along with her little one by a lot of otters These playful animals cavort and rollick in the starlight until Mother Moon looks down and sees them and her child safe and sound Item Media Type SRP RAH811863S

Turning Heads Shaping Minds since 2014

Turning Heads Shaping Minds since 2014

10 11 ages 3 to 5 A l s o A v a i l a b l e MagnetologyTM Construction Sites 19 99 U S 12 99 U K HC 979 1 02760 145 5 MagnetologyTM New Homes for Our Little Friends

REVISED SCHEME OF TEACHING amp EXAMINATION Dated 19

REVISED SCHEME OF TEACHING amp EXAMINATION Dated 19

10ES32 ANALOG ELECTRONIC CIRCUITS Co mmon to EC TC EE IT BM ML Subject Code 10MAT31 IA Marks 25 No of Lecture Hrs Week 04 Exam Hours 03 Total No of Lecture Hrs 52 Exam Marks 100 Subject Code 10ES32 IA Marks 25 No of Lecture Hrs Week 04 Exam Hours 03 Total No of Lecture Hrs 52 Exam Marks 100 2 10ES33 LOGIC DESIGN Common to EC TC EE IT BM ML 10ES34 NETWORK

Technical Reference Manual Espressif

Technical Reference Manual Espressif

The ESP32 Technical Reference Manual is addressed to application developers The manual provides detailed and complete information on how to use the ESP32 memory and peripherals For pin definition electrical characteristics and package information please see ESP32Datasheet Document Updates

ESP32

ESP32

ESP32 4 1 2019 www espressif com

Windows 10 Pas Pas Pour les Nuls

Windows 10 Pas Pas Pour les Nuls

Windows 10 Pas Pas pour les Nuls Pour les Nuls est une marque d pos e de Wiley Publishing Inc For Dummies est une marque d pos e de Wiley Publishing Inc

Analog electronic Circuits 10ES32 VTU Updates

Analog electronic Circuits 10ES32 VTU Updates

Analog electronic Circuits 15EE34 Department of EEE SJBIT Page 3 Module 1 Diode circuits Diode A pure silicon crystal or germanium crystal is known as an intrinsic semiconductor There are not enough free electrons and holes in an intrinsic semi conductor to produce a usable current The